Incidental Mutation 'R7553:Capn5'
ID 584553
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 045622-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7553 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97773231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 591 (F591S)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
AlphaFold O08688
Predicted Effect probably damaging
Transcript: ENSMUST00000040971
AA Change: F591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: F591S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107112
AA Change: F591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: F591S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Meta Mutation Damage Score 0.9293 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,648,545 (GRCm39) L649P probably damaging Het
Acad10 T C 5: 121,777,318 (GRCm39) Y371C probably damaging Het
Avp A G 2: 130,423,098 (GRCm39) V71A probably damaging Het
Bhmt C T 13: 93,756,589 (GRCm39) probably null Het
Capn15 T C 17: 26,179,738 (GRCm39) E874G probably damaging Het
Ccne2 A T 4: 11,201,348 (GRCm39) Q292L probably benign Het
Cd96 T G 16: 45,872,384 (GRCm39) T406P probably damaging Het
Csnk1e G A 15: 79,310,566 (GRCm39) A153V probably damaging Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Dmbt1 A G 7: 130,706,597 (GRCm39) N1372S unknown Het
Dntt A T 19: 41,017,926 (GRCm39) R17W probably damaging Het
Erich3 G T 3: 154,439,137 (GRCm39) A260S probably benign Het
Foxp2 C T 6: 15,437,881 (GRCm39) S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Grid2 A G 6: 64,053,925 (GRCm39) K375E possibly damaging Het
Grin2b C T 6: 135,749,394 (GRCm39) G603S possibly damaging Het
Hexb C T 13: 97,334,681 (GRCm39) R30Q probably benign Het
Homer3 A T 8: 70,742,774 (GRCm39) T162S probably benign Het
L3mbtl1 A G 2: 162,790,151 (GRCm39) E15G probably benign Het
Manea A T 4: 26,327,986 (GRCm39) F352I probably damaging Het
Mcf2l T A 8: 13,047,268 (GRCm39) M210K probably benign Het
Morc3 T C 16: 93,667,824 (GRCm39) L734P probably damaging Het
Mybpc2 A G 7: 44,155,571 (GRCm39) V894A possibly damaging Het
Myh4 T A 11: 67,147,221 (GRCm39) M1622K probably damaging Het
Myrf A G 19: 10,206,240 (GRCm39) F59L probably benign Het
Ndst3 G T 3: 123,350,709 (GRCm39) probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nos3 A T 5: 24,586,715 (GRCm39) D986V possibly damaging Het
Nrp1 G A 8: 129,158,468 (GRCm39) A252T probably damaging Het
Nup205 G T 6: 35,178,934 (GRCm39) R668L probably damaging Het
Or51aa2 T C 7: 103,188,363 (GRCm39) Y26C probably damaging Het
Or5af2 T A 11: 58,707,886 (GRCm39) D17E probably benign Het
Or5p56 G A 7: 107,589,682 (GRCm39) V37I probably benign Het
Pcdhga1 T A 18: 37,882,735 (GRCm39) probably null Het
Pck1 A G 2: 172,998,860 (GRCm39) I373V probably benign Het
Pde8b T C 13: 95,223,258 (GRCm39) N227S probably benign Het
Pianp T G 6: 124,976,214 (GRCm39) S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2r1 A T 2: 60,353,243 (GRCm39) N239K possibly damaging Het
Pls1 T A 9: 95,669,140 (GRCm39) N27I probably damaging Het
Prep T C 10: 45,034,620 (GRCm39) *711Q probably null Het
Prkag3 A G 1: 74,783,894 (GRCm39) F330L probably damaging Het
Prss56 A G 1: 87,111,261 (GRCm39) D16G probably benign Het
Rad17 A T 13: 100,769,794 (GRCm39) F255Y probably damaging Het
Rap1gap2 T C 11: 74,326,548 (GRCm39) E173G probably damaging Het
Retreg3 C T 11: 100,997,216 (GRCm39) R88H possibly damaging Het
Rhag G A 17: 41,139,286 (GRCm39) G74R probably damaging Het
Rybp A G 6: 100,209,220 (GRCm39) S201P possibly damaging Het
S100a10 G A 3: 93,471,602 (GRCm39) C62Y probably benign Het
Scgb2b3 T A 7: 31,059,673 (GRCm39) S34C possibly damaging Het
Serpind1 A G 16: 17,154,539 (GRCm39) D122G probably benign Het
Setdb1 A G 3: 95,254,076 (GRCm39) L242P probably damaging Het
Slc14a2 T A 18: 78,198,803 (GRCm39) I776F probably damaging Het
Slc9a1 A G 4: 133,139,580 (GRCm39) E266G probably damaging Het
Stard9 A T 2: 120,524,289 (GRCm39) probably null Het
Stpg2 A G 3: 138,924,098 (GRCm39) Y167C probably damaging Het
Tex264 T C 9: 106,536,335 (GRCm39) E274G probably damaging Het
Tigd2 G A 6: 59,188,564 (GRCm39) S477N probably benign Het
Urb1 A G 16: 90,589,752 (GRCm39) L343P probably damaging Het
Vars2 A T 17: 35,975,680 (GRCm39) C246S possibly damaging Het
Vil1 G A 1: 74,465,891 (GRCm39) probably null Het
Vmn2r61 C G 7: 41,916,205 (GRCm39) L273V not run Het
Vmn2r-ps158 T G 7: 42,697,447 (GRCm39) C835G probably damaging Het
Zfp37 C A 4: 62,110,236 (GRCm39) G317V probably damaging Het
Zfp760 A G 17: 21,941,872 (GRCm39) K349R possibly damaging Het
Zyx A T 6: 42,327,408 (GRCm39) E69V probably null Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGGGAATTCTTTGGGGC -3'
(R):5'- ATCAGTCCATGGGCTTTTCC -3'

Sequencing Primer
(F):5'- TCTCTTCAGGTCACACAGTGGG -3'
(R):5'- CCTGACTGGGCTTGCACTG -3'
Posted On 2019-10-17