Incidental Mutation 'R7553:Capn5'
ID584553
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Namecalpain 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98121559-98178274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98124024 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 591 (F591S)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
Predicted Effect probably damaging
Transcript: ENSMUST00000040971
AA Change: F591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: F591S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107112
AA Change: F591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: F591S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Meta Mutation Damage Score 0.9293 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 98135764 missense probably damaging 1.00
IGL01311:Capn5 APN 7 98161923 missense probably damaging 1.00
IGL01768:Capn5 APN 7 98125273 missense probably damaging 1.00
IGL01926:Capn5 APN 7 98128472 critical splice donor site probably null
IGL02076:Capn5 APN 7 98131743 nonsense probably null
IGL02505:Capn5 APN 7 98131196 missense possibly damaging 0.85
BB007:Capn5 UTSW 7 98123878 missense probably benign
BB017:Capn5 UTSW 7 98123878 missense probably benign
PIT4466001:Capn5 UTSW 7 98123988 missense probably benign 0.00
R0178:Capn5 UTSW 7 98132891 missense probably damaging 1.00
R0518:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R0521:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R1459:Capn5 UTSW 7 98131842 missense possibly damaging 0.84
R2005:Capn5 UTSW 7 98129363 missense probably benign
R2258:Capn5 UTSW 7 98135875 missense probably damaging 0.99
R2327:Capn5 UTSW 7 98126367 missense probably benign 0.07
R3797:Capn5 UTSW 7 98125829 missense probably null 0.77
R4032:Capn5 UTSW 7 98129246 missense probably damaging 0.96
R4620:Capn5 UTSW 7 98129371 missense probably damaging 0.98
R4717:Capn5 UTSW 7 98123919 missense probably benign 0.02
R4777:Capn5 UTSW 7 98131718 missense probably damaging 1.00
R4823:Capn5 UTSW 7 98126441 missense probably damaging 1.00
R4841:Capn5 UTSW 7 98131672 splice site probably null
R4965:Capn5 UTSW 7 98126417 missense probably damaging 0.99
R5568:Capn5 UTSW 7 98125930 missense probably damaging 1.00
R5732:Capn5 UTSW 7 98129386 missense possibly damaging 0.95
R5792:Capn5 UTSW 7 98131195 missense probably benign 0.09
R6892:Capn5 UTSW 7 98135941 missense probably damaging 1.00
R6923:Capn5 UTSW 7 98129254 missense probably damaging 1.00
R7095:Capn5 UTSW 7 98125831 missense probably benign 0.10
R7391:Capn5 UTSW 7 98131219 missense probably benign 0.02
R7930:Capn5 UTSW 7 98123878 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACGGGAATTCTTTGGGGC -3'
(R):5'- ATCAGTCCATGGGCTTTTCC -3'

Sequencing Primer
(F):5'- TCTCTTCAGGTCACACAGTGGG -3'
(R):5'- CCTGACTGGGCTTGCACTG -3'
Posted On2019-10-17