Incidental Mutation 'R7553:Olfr612'
ID584554
Institutional Source Beutler Lab
Gene Symbol Olfr612
Ensembl Gene ENSMUSG00000094119
Gene Nameolfactory receptor 612
SynonymsMOR15-3, GA_x6K02T2PBJ9-6251685-6250741, EG545985
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103537222-103542717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103539156 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 26 (Y26C)
Ref Sequence ENSEMBL: ENSMUSP00000150524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104879] [ENSMUST00000214269] [ENSMUST00000215663]
Predicted Effect probably damaging
Transcript: ENSMUST00000104879
AA Change: Y26C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100473
Gene: ENSMUSG00000094119
AA Change: Y26C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 37 309 4.7e-11 PFAM
Pfam:7tm_1 43 294 3.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214269
AA Change: Y26C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215663
AA Change: Y26C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Olfr612
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Olfr612 APN 7 103538574 missense probably damaging 1.00
IGL01901:Olfr612 APN 7 103538970 missense probably damaging 0.98
R1200:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R1591:Olfr612 UTSW 7 103539067 missense probably benign 0.00
R1858:Olfr612 UTSW 7 103538652 missense probably damaging 1.00
R1975:Olfr612 UTSW 7 103538994 missense probably damaging 1.00
R1994:Olfr612 UTSW 7 103538359 missense possibly damaging 0.57
R3690:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R4635:Olfr612 UTSW 7 103539148 missense probably benign 0.00
R4670:Olfr612 UTSW 7 103539186 missense possibly damaging 0.89
R5267:Olfr612 UTSW 7 103538824 missense probably benign 0.19
R5417:Olfr612 UTSW 7 103538763 missense possibly damaging 0.94
R6644:Olfr612 UTSW 7 103539058 missense possibly damaging 0.94
R7253:Olfr612 UTSW 7 103538788 missense probably benign 0.01
R7278:Olfr612 UTSW 7 103538728 missense probably benign 0.02
R7525:Olfr612 UTSW 7 103539131 nonsense probably null
R7661:Olfr612 UTSW 7 103538619 missense probably damaging 0.99
R8379:Olfr612 UTSW 7 103538976 missense possibly damaging 0.91
R8493:Olfr612 UTSW 7 103538272 missense probably benign 0.01
R8774:Olfr612 UTSW 7 103538758 missense probably benign 0.00
R8774-TAIL:Olfr612 UTSW 7 103538758 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTGTGAAACAAGCAGTGG -3'
(R):5'- CAAAGGAATGTGCATTCAAGGTAC -3'

Sequencing Primer
(F):5'- AAGCAGTGGTGGTCAACTCTCTATC -3'
(R):5'- CAAAGATTATAGAGACAGTGCTCTGC -3'
Posted On2019-10-17