Incidental Mutation 'R7553:Homer3'
ID584559
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Namehomer scaffolding protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70282827-70294361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70290124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 162 (T162S)
Ref Sequence ENSEMBL: ENSMUSP00000003669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect probably benign
Transcript: ENSMUST00000003669
AA Change: T162S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: T162S

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110124
AA Change: T162S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: T162S

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135368
Predicted Effect probably benign
Transcript: ENSMUST00000140212
AA Change: T162S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: T162S

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70290157 missense probably damaging 0.96
IGL02493:Homer3 APN 8 70290071 missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70286335 missense probably benign 0.00
R2436:Homer3 UTSW 8 70293056 missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70291355 missense probably benign 0.06
R4391:Homer3 UTSW 8 70290143 splice site probably null
R4392:Homer3 UTSW 8 70290143 splice site probably null
R4395:Homer3 UTSW 8 70290143 splice site probably null
R4396:Homer3 UTSW 8 70290143 splice site probably null
R4397:Homer3 UTSW 8 70290143 splice site probably null
R4401:Homer3 UTSW 8 70290143 splice site probably null
R4402:Homer3 UTSW 8 70290143 splice site probably null
R4445:Homer3 UTSW 8 70290143 splice site probably null
R4446:Homer3 UTSW 8 70290143 splice site probably null
R4482:Homer3 UTSW 8 70290143 splice site probably null
R4488:Homer3 UTSW 8 70290143 splice site probably null
R4489:Homer3 UTSW 8 70290143 splice site probably null
R4664:Homer3 UTSW 8 70290143 splice site probably null
R4666:Homer3 UTSW 8 70290143 splice site probably null
R4751:Homer3 UTSW 8 70285434 missense probably damaging 1.00
R5071:Homer3 UTSW 8 70291355 missense probably benign
R5828:Homer3 UTSW 8 70286306 missense probably benign 0.02
R6052:Homer3 UTSW 8 70291426 nonsense probably null
R6211:Homer3 UTSW 8 70285524 missense probably damaging 1.00
R6234:Homer3 UTSW 8 70291165 critical splice donor site probably null
R6895:Homer3 UTSW 8 70285305 missense probably damaging 0.99
R6914:Homer3 UTSW 8 70291551 missense probably benign 0.00
R6942:Homer3 UTSW 8 70291551 missense probably benign 0.00
R7300:Homer3 UTSW 8 70285303 start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70289484 missense probably benign 0.00
R7555:Homer3 UTSW 8 70289413 missense probably damaging 1.00
R7721:Homer3 UTSW 8 70291012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCAATACCCCAGTGGCTTC -3'
(R):5'- CCTTTAGTGACAATCAAGACCCTG -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On2019-10-17