Incidental Mutation 'R7553:Pkd1l3'
ID584560
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7553 (G1)
Quality Score201.458
Status Not validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationsmall deletion (13 aa in frame mutation)
DNA Base Change (assembly) GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA at 109624195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect probably benign
Transcript: ENSMUST00000057344
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109242
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212537
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
BB006:Pkd1l3 UTSW 8 109624195 small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1464:Pkd1l3 UTSW 8 109636427 splice site probably benign
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 109632605 missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 splice site probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 109623212 missense unknown
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 splice site probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 109672585 missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 109638417 missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 109614572 missense unknown
R7749:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7751:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7755:Pkd1l3 UTSW 8 109630166 missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7831:Pkd1l3 UTSW 8 109631358 missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7849:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7917:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7929:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7952:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8054:Pkd1l3 UTSW 8 109646376 missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8099:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8276:Pkd1l3 UTSW 8 109670721 makesense probably null
R8352:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8376:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R8377:Pkd1l3 UTSW 8 109635350 missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 109633390 missense possibly damaging 0.85
RF016:Pkd1l3 UTSW 8 109623542 missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 109624195 small deletion probably benign
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z1176:Pkd1l3 UTSW 8 109623242 missense unknown
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACATCAGACACACCTG -3'
(R):5'- AGTCTTCCTGTGCCTTTGAAG -3'

Sequencing Primer
(F):5'- TGACATCAGACACACCTGCATCC -3'
(R):5'- GTTTGCCAAAGATCTTCCAGCAGG -3'
Posted On2019-10-17