Incidental Mutation 'R7553:Pls1'
ID584562
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95787087 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 27 (N27I)
Ref Sequence ENSEMBL: ENSMUSP00000091317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093800] [ENSMUST00000119760]
Predicted Effect probably damaging
Transcript: ENSMUST00000093800
AA Change: N27I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: N27I

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119760
AA Change: N27I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113200
Gene: ENSMUSG00000049493
AA Change: N27I

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
PDB:1AOA|A 117 138 2e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
PIT4585001:Pls1 UTSW 9 95761390 missense probably benign
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2015:Pls1 UTSW 9 95761365 missense possibly damaging 0.77
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R2985:Pls1 UTSW 9 95785582 missense possibly damaging 0.73
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6441:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7016:Pls1 UTSW 9 95786941 missense probably damaging 1.00
R7177:Pls1 UTSW 9 95773559 missense probably benign 0.01
R7458:Pls1 UTSW 9 95785507 missense probably damaging 1.00
R7467:Pls1 UTSW 9 95769113 missense possibly damaging 0.78
R7536:Pls1 UTSW 9 95762057 missense probably damaging 1.00
R7691:Pls1 UTSW 9 95773673 missense probably benign 0.21
R7756:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7758:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7876:Pls1 UTSW 9 95785505 nonsense probably null
R8269:Pls1 UTSW 9 95761970 missense probably damaging 1.00
R8380:Pls1 UTSW 9 95775385 missense probably benign 0.03
Z1177:Pls1 UTSW 9 95754387 missense probably damaging 0.99
Z1177:Pls1 UTSW 9 95785618 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTATTGGACTACTCACCGACACG -3'
(R):5'- ACACCCTGTATCGTTCAGATTTAGG -3'

Sequencing Primer
(F):5'- CGAACTCCTCAAAACTGATTTTACC -3'
(R):5'- GGAATAAAGTGCTGATTCTCGCCC -3'
Posted On2019-10-17