Incidental Mutation 'R7553:Hexb'
ID584572
Institutional Source Beutler Lab
Gene Symbol Hexb
Ensembl Gene ENSMUSG00000021665
Gene Namehexosaminidase B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97176331-97198357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97198173 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 30 (R30Q)
Ref Sequence ENSEMBL: ENSMUSP00000022169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169]
Predicted Effect probably benign
Transcript: ENSMUST00000022169
AA Change: R30Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665
AA Change: R30Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Hexb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hexb APN 13 97181929 missense probably damaging 1.00
IGL02010:Hexb APN 13 97176845 missense probably benign 0.01
IGL02126:Hexb APN 13 97178024 missense possibly damaging 0.93
IGL02303:Hexb APN 13 97176893 missense probably damaging 1.00
IGL02955:Hexb APN 13 97181076 utr 3 prime probably benign
IGL02988:Hexb UTSW 13 97198221 missense unknown
R0311:Hexb UTSW 13 97183819 unclassified probably benign
R0470:Hexb UTSW 13 97177999 missense probably damaging 0.97
R0520:Hexb UTSW 13 97181110 missense probably benign 0.00
R0893:Hexb UTSW 13 97185627 missense probably benign 0.02
R1869:Hexb UTSW 13 97191259 missense probably benign
R2295:Hexb UTSW 13 97185612 missense probably damaging 1.00
R2884:Hexb UTSW 13 97183700 missense probably damaging 1.00
R4237:Hexb UTSW 13 97176751 intron probably benign
R4238:Hexb UTSW 13 97176751 intron probably benign
R4239:Hexb UTSW 13 97176751 intron probably benign
R4689:Hexb UTSW 13 97181092 missense probably damaging 1.00
R5166:Hexb UTSW 13 97182004 missense probably benign 0.13
R6665:Hexb UTSW 13 97179385 missense probably benign 0.01
R7379:Hexb UTSW 13 97181164 missense probably damaging 1.00
R8307:Hexb UTSW 13 97194199 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCCTGTGAGACCCAAGTAGC -3'
(R):5'- GGTCATCTGACTTGGTGACC -3'

Sequencing Primer
(F):5'- AAGTAGCCCGGCGATCCTTC -3'
(R):5'- ACTTGGTGACCCGGGCAC -3'
Posted On2019-10-17