Incidental Mutation 'R7553:Nln'
ID584574
Institutional Source Beutler Lab
Gene Symbol Nln
Ensembl Gene ENSMUSG00000021710
Gene Nameneurolysin (metallopeptidase M3 family)
Synonyms4930472G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7553 (G1)
Quality Score214.458
Status Validated
Chromosome13
Chromosomal Location104023057-104109614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC to TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC at 104050416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109315] [ENSMUST00000224945]
Predicted Effect probably null
Transcript: ENSMUST00000109315
SMART Domains Protein: ENSMUSP00000104938
Gene: ENSMUSG00000021710

DomainStartEndE-ValueType
Pfam:Peptidase_M3 251 701 1.8e-158 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224945
Predicted Effect probably benign
Transcript: ENSMUST00000225324
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit increased glucose tolerance, insulin sensitivity, and gluconeogensis. Mice also show decreased body weight and run less in a low intensity regime to exhaustion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Nln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nln APN 13 104035645 missense probably damaging 1.00
IGL01656:Nln APN 13 104061741 splice site probably null
R0025:Nln UTSW 13 104036891 missense probably damaging 0.98
R0294:Nln UTSW 13 104052579 missense probably damaging 1.00
R1396:Nln UTSW 13 104061753 missense probably benign 0.01
R1657:Nln UTSW 13 104036947 missense possibly damaging 0.94
R2087:Nln UTSW 13 104037369 missense probably damaging 0.96
R2847:Nln UTSW 13 104025025 missense probably damaging 1.00
R3034:Nln UTSW 13 104037439 missense possibly damaging 0.91
R5576:Nln UTSW 13 104058830 missense probably damaging 1.00
R5585:Nln UTSW 13 104025061 missense possibly damaging 0.73
R5882:Nln UTSW 13 104059498 missense probably benign 0.08
R6763:Nln UTSW 13 104035655 missense probably damaging 1.00
R7209:Nln UTSW 13 104072898 nonsense probably null
R7347:Nln UTSW 13 104050847 missense probably damaging 0.96
R7417:Nln UTSW 13 104036970 missense probably damaging 1.00
R7467:Nln UTSW 13 104025022 missense possibly damaging 0.75
R7491:Nln UTSW 13 104069323 missense probably damaging 1.00
R7842:Nln UTSW 13 104052629 missense probably benign
X0020:Nln UTSW 13 104061810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATTCTGGCTTCAGAGC -3'
(R):5'- TGCCCATGTTTGGAATAAGAGTG -3'

Sequencing Primer
(F):5'- TTGTAGACCAAGCTGGCTCTGAAC -3'
(R):5'- GTTTCACTTTACACCGTGAAGG -3'
Posted On2019-10-17