Incidental Mutation 'R7553:Csnk1e'
ID584575
Institutional Source Beutler Lab
Gene Symbol Csnk1e
Ensembl Gene ENSMUSG00000022433
Gene Namecasein kinase 1, epsilon
SynonymsCKIepsilon, KC1epsilon, CKI epsilon, CK1epsilon, tau
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79417856-79455566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79426366 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 153 (A153V)
Ref Sequence ENSEMBL: ENSMUSP00000113341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044] [ENSMUST00000135519] [ENSMUST00000144790] [ENSMUST00000156043] [ENSMUST00000229510] [ENSMUST00000230599] [ENSMUST00000230942]
Predicted Effect probably damaging
Transcript: ENSMUST00000117786
AA Change: A153V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: A153V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 8.7e-18 PFAM
Pfam:Pkinase 9 277 5.2e-28 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120859
AA Change: A153V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: A153V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 9.8e-18 PFAM
Pfam:Pkinase 9 280 7e-40 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122044
AA Change: A153V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433
AA Change: A153V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 7.9e-18 PFAM
Pfam:Pkinase 9 280 5.7e-40 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 345 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135519
SMART Domains Protein: ENSMUSP00000122135
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase 9 118 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144790
SMART Domains Protein: ENSMUSP00000115637
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase 9 141 9.3e-24 PFAM
Pfam:Pkinase_Tyr 9 141 5.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156043
SMART Domains Protein: ENSMUSP00000116593
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase 9 60 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229510
Predicted Effect probably damaging
Transcript: ENSMUST00000230599
AA Change: A153V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230942
Meta Mutation Damage Score 0.8505 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Csnk1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0624:Csnk1e UTSW 15 79419898 unclassified probably benign
R1281:Csnk1e UTSW 15 79420641 missense possibly damaging 0.80
R1618:Csnk1e UTSW 15 79424850 missense probably benign 0.02
R3005:Csnk1e UTSW 15 79438805 missense probably benign 0.42
R4241:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4242:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4276:Csnk1e UTSW 15 79429767 missense probably damaging 1.00
R4438:Csnk1e UTSW 15 79420929 missense probably benign 0.08
R4994:Csnk1e UTSW 15 79424929 missense probably damaging 1.00
R5071:Csnk1e UTSW 15 79420872 nonsense probably null
R7072:Csnk1e UTSW 15 79438767 splice site probably null
R8379:Csnk1e UTSW 15 79420682 missense possibly damaging 0.88
R8721:Csnk1e UTSW 15 79429815 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAACTCAGGTAGGGACATAGGC -3'
(R):5'- CATACTGAGACTAGGTCTTTCCTCC -3'

Sequencing Primer
(F):5'- TCAGGTAGGGACATAGGCCCATC -3'
(R):5'- TTTCCTCCTGGGCAGAACAG -3'
Posted On2019-10-17