Incidental Mutation 'R7553:Capn15'
ID584581
Institutional Source Beutler Lab
Gene Symbol Capn15
Ensembl Gene ENSMUSG00000037326
Gene Namecalpain 15
SynonymsSolh
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25958364-25985796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25960764 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 874 (E874G)
Ref Sequence ENSEMBL: ENSMUSP00000148486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041641] [ENSMUST00000181174] [ENSMUST00000212099] [ENSMUST00000212149] [ENSMUST00000212520] [ENSMUST00000212789]
Predicted Effect probably damaging
Transcript: ENSMUST00000041641
AA Change: E808G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039528
Gene: ENSMUSG00000037326
AA Change: E808G

DomainStartEndE-ValueType
ZnF_RBZ 5 29 8.92e-8 SMART
ZnF_RBZ 46 70 3.46e-5 SMART
low complexity region 117 150 N/A INTRINSIC
ZnF_RBZ 151 175 2.28e-5 SMART
low complexity region 184 196 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 280 301 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
ZnF_RBZ 352 376 1.21e-4 SMART
ZnF_RBZ 424 448 4.78e-8 SMART
CysPc 479 811 6.54e-132 SMART
low complexity region 868 879 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 972 981 N/A INTRINSIC
Blast:CysPc 982 1028 9e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181174
Predicted Effect probably benign
Transcript: ENSMUST00000212099
Predicted Effect probably damaging
Transcript: ENSMUST00000212149
AA Change: E808G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212520
AA Change: E874G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000212789
AA Change: E808G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc-finger-like repeats and a calpain-like protease domain. The encoded protein may function as a transcription factor, RNA-binding protein, or in protein-protein interactions during visual system development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Capn15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Capn15 APN 17 25963050 missense probably damaging 1.00
IGL01568:Capn15 APN 17 25965445 missense probably damaging 0.99
IGL01724:Capn15 APN 17 25962063 missense probably damaging 1.00
IGL01934:Capn15 APN 17 25963024 missense probably damaging 1.00
IGL02700:Capn15 APN 17 25963008 missense probably damaging 1.00
IGL03274:Capn15 APN 17 25961838 missense probably damaging 1.00
ANU74:Capn15 UTSW 17 25965486 nonsense probably null
R1350:Capn15 UTSW 17 25964692 missense probably benign 0.00
R1491:Capn15 UTSW 17 25964479 missense probably damaging 1.00
R1632:Capn15 UTSW 17 25960665 missense probably damaging 0.99
R1696:Capn15 UTSW 17 25964904 missense probably benign 0.01
R1871:Capn15 UTSW 17 25964229 missense probably damaging 1.00
R1914:Capn15 UTSW 17 25964863 missense probably benign 0.03
R2295:Capn15 UTSW 17 25964581 nonsense probably null
R4579:Capn15 UTSW 17 25959837 missense probably damaging 0.99
R4658:Capn15 UTSW 17 25960768 missense probably benign 0.11
R5790:Capn15 UTSW 17 25964547 missense probably benign 0.08
R6455:Capn15 UTSW 17 25965436 missense probably damaging 1.00
R6639:Capn15 UTSW 17 25960178 missense probably benign 0.00
R6882:Capn15 UTSW 17 25960179 splice site probably null
R7052:Capn15 UTSW 17 25961750 missense probably damaging 1.00
R7157:Capn15 UTSW 17 25965254 missense probably damaging 1.00
R7287:Capn15 UTSW 17 25960455 missense probably damaging 1.00
R7555:Capn15 UTSW 17 25963432 missense probably damaging 1.00
R7706:Capn15 UTSW 17 25964151 missense probably benign 0.00
Z1088:Capn15 UTSW 17 25963347 missense probably damaging 1.00
Z1177:Capn15 UTSW 17 25973220 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGAGGTGGCTGTCTACTGAATC -3'
(R):5'- AGACAGCCTGCTATGAGTGC -3'

Sequencing Primer
(F):5'- TGGCTGTCTACTGAATCCGAGC -3'
(R):5'- CCTGCTATGAGTGCTAGAAGC -3'
Posted On2019-10-17