Incidental Mutation 'R7553:Vars2'
ID584582
Institutional Source Beutler Lab
Gene Symbol Vars2
Ensembl Gene ENSMUSG00000038838
Gene Namevalyl-tRNA synthetase 2, mitochondrial
SynonymsVars2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35655634-35667592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35664788 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 246 (C246S)
Ref Sequence ENSEMBL: ENSMUSP00000047917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000165144] [ENSMUST00000169093]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000043674
AA Change: C246S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838
AA Change: C246S

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160734
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164404
SMART Domains Protein: ENSMUSP00000126084
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 201 1e-49 PFAM
Pfam:tRNA-synt_1g 68 172 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect probably benign
Transcript: ENSMUST00000168922
SMART Domains Protein: ENSMUSP00000129196
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 2 386 3e-105 PFAM
Pfam:Anticodon_1 430 566 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169093
SMART Domains Protein: ENSMUSP00000126794
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 109 1.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Vars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Vars2 APN 17 35664621 unclassified probably benign
IGL02320:Vars2 APN 17 35660454 missense probably benign 0.07
IGL02580:Vars2 APN 17 35660885 missense possibly damaging 0.50
IGL02691:Vars2 APN 17 35660248 missense probably damaging 1.00
IGL03039:Vars2 APN 17 35664121 missense probably damaging 1.00
PIT4445001:Vars2 UTSW 17 35666211 nonsense probably null
R0079:Vars2 UTSW 17 35659156 missense probably damaging 0.99
R0152:Vars2 UTSW 17 35660027 missense probably damaging 1.00
R0346:Vars2 UTSW 17 35664864 unclassified probably benign
R0426:Vars2 UTSW 17 35664584 missense probably damaging 1.00
R0584:Vars2 UTSW 17 35666686 missense possibly damaging 0.82
R0589:Vars2 UTSW 17 35659176 missense probably benign
R0882:Vars2 UTSW 17 35657299 missense probably benign 0.41
R1234:Vars2 UTSW 17 35667146 missense probably damaging 1.00
R1263:Vars2 UTSW 17 35661609 missense probably damaging 1.00
R1559:Vars2 UTSW 17 35666258 unclassified probably benign
R1772:Vars2 UTSW 17 35660084 missense probably damaging 1.00
R1809:Vars2 UTSW 17 35662216 missense probably damaging 1.00
R1913:Vars2 UTSW 17 35666922 missense probably benign 0.02
R1986:Vars2 UTSW 17 35660061 missense probably damaging 1.00
R2504:Vars2 UTSW 17 35664793 missense probably damaging 1.00
R3426:Vars2 UTSW 17 35661974 missense probably damaging 1.00
R4539:Vars2 UTSW 17 35666888 missense probably damaging 0.99
R4751:Vars2 UTSW 17 35659343 missense possibly damaging 0.89
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R5028:Vars2 UTSW 17 35659473 critical splice donor site probably null
R5217:Vars2 UTSW 17 35658149 missense probably damaging 1.00
R5292:Vars2 UTSW 17 35660786 missense probably damaging 1.00
R6056:Vars2 UTSW 17 35665788 missense probably benign 0.01
R6211:Vars2 UTSW 17 35665662 splice site probably null
R6213:Vars2 UTSW 17 35660440 missense probably benign 0.27
R6374:Vars2 UTSW 17 35660045 missense probably damaging 1.00
R6746:Vars2 UTSW 17 35660402 critical splice donor site probably null
R6749:Vars2 UTSW 17 35666713 missense probably damaging 1.00
R6957:Vars2 UTSW 17 35667075 missense probably benign 0.39
R7107:Vars2 UTSW 17 35658250 missense probably damaging 1.00
R7428:Vars2 UTSW 17 35666686 missense probably benign 0.00
R7538:Vars2 UTSW 17 35660780 missense probably damaging 1.00
R7741:Vars2 UTSW 17 35660943 missense probably damaging 1.00
R7784:Vars2 UTSW 17 35658158 missense possibly damaging 0.95
R7823:Vars2 UTSW 17 35659136 missense probably damaging 1.00
R7915:Vars2 UTSW 17 35664839 missense probably damaging 1.00
R8201:Vars2 UTSW 17 35658310 missense probably benign
X0021:Vars2 UTSW 17 35659034 missense possibly damaging 0.93
Z1176:Vars2 UTSW 17 35664791 missense possibly damaging 0.55
Z1177:Vars2 UTSW 17 35663472 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTGGAACGATCTGAATGTCCATAC -3'
(R):5'- TTAAAGCCATAGGACGCCCC -3'

Sequencing Primer
(F):5'- GATCTGAATGTCCATACCTGACG -3'
(R):5'- GGTTCTATCTCCATCAGCGGG -3'
Posted On2019-10-17