Incidental Mutation 'R0617:Abca5'

• ID: 58460
• Institutional Source: Beutler Lab
• Gene Symbol: Abca5
• Ensembl Gene: ENSMUSG00000018800
• Gene Name: ATP-binding cassette, sub-family A (ABC1), member 5
• Synonyms: ABC13, B930033A02Rik
• MMRRC Submission: 038806-MU
• Accession Numbers:

  NCBI RefSeq: NM_147219.2; MGI: 2386607

• Is this an essential gene?: Probably non essential (E-score: 0.141)
• Stock #: R0617 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 110269369-110337716 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to T at 110279689 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Aspartic acid to Glutamic Acid at position 1265 (D1265E)
• Ref Sequence: ENSEMBL: ENSMUSP00000047927
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000043961]
• AlphaFold: Q8K448
• Predicted Effect: probably damaging; Transcript: ENSMUST00000043961; AA Change: D1265E; PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
• SMART Domains: Protein: ENSMUSP00000047927; Gene: ENSMUSG00000018800; AA Change: D1265E

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

• Meta Mutation Damage Score: 0.1766
• Coding Region Coverage:
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
• Validation Efficiency: 98% (130/133)
• MGI Phenotype: Strain: 3581814; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
• Allele List at MGI:

  All alleles(3) : Targeted(3)

• Posted On: 2013-07-11
• Science Writer: Anne Murray

Predicted Primers

PCR Primer
(F):5'- CAGCTCCATTTGGACCCAACAGTC -3'
(R):5'- TGAAGCACTAACAGCCAATGAGCAG -3'

Sequencing Primer
(F):5'- TTCACCTCTAAGAGGGCAGTG -3'
(R):5'- GCCAATGAGCAGTACCATTTGTG -3'

Protein Function and Prediction

Abca5 encodes ABCA5, a member of the A subfamily of ATP-binding cassette (ABC) transporters that function to translocate molecules across cellular membranes. ABCA5 has up to 12 transmembane segments in two transmembrane domains as well as two nucleotide-binding domains (1;2). The nucleotide-binding domains contain three motifs: Walker A, B, and C motifs. ABCA5 is expressed in the heart, liver, and skeletal muscle (3). Further, a study detected moderate ABCA5 in all tissues examined; highest levels were in the skeletal muscle and cerebellum (4). In the mouse, Abca5 is expresses three transcripts with high expression in the brain, testis, and lung, and lower expression in the heart, liver, kidney, skeletal muscle, and placenta. ABCA5 is localized to the cardiomyocytes of the heart, oligodendrocytes and astrocytes of brain, alveolar type II cells of the lung, and in a lysosome-related compartment of lung epithelial cells (1).

 

Abca5^{tm1Akya/tm1Akya}; MGI:3581814

involves: C57BL/6NCrj * CBA/JNCrj

Homozygotes exhibit myocardial fiber degeneration and dilated cardiomyopathy as well as thrombosis, collapse of follicles of the thyroid, decreased thyroid activity, exophthalmos, and liver injury (1).

 

Abca5^{tm1Akya/tm1Akya}; MGI:3581814

involves: C57BL/6NCrlj * CBA/JNCrlj * ICR

Homozygotes on this genetic background exhibit premature death, visceral vascular congestion, myocardial fiber degeneration, dilated cardiomyopathy, thrombosis, edema, collapse of follicles of the thyroid, exophthalmos, liver injury, and tremors (1).

References

  1. Kubo, Y., Sekiya, S., Ohigashi, M., Takenaka, C., Tamura, K., Nada, S., Nishi, T., Yamamoto, A., and Yamaguchi, A. (2005) ABCA5 Resides in Lysosomes, and ABCA5 Knockout Mice Develop Lysosomal Disease-Like Symptoms. Mol Cell Biol. 25, 4138-4149.

  2. Petry, F., Kotthaus, A., and Hirsch-Ernst, K. I. (2003) Cloning of Human and Rat ABCA5/Abca5 and Detection of a Human Splice Variant. Biochem Biophys Res Commun. 300, 343-350.

  3. Allikmets, R., Gerrard, B., Hutchinson, A., and Dean, M. (1996) Characterization of the Human ABC Superfamily: Isolation and Mapping of 21 New Genes using the Expressed Sequence Tags Database. Hum Mol Genet. 5, 1649-1655.

  4. Nagase, T., Kikuno, R., and Ohara, O. (2001) Prediction of the Coding Sequences of Unidentified Human Genes. XXI. the Complete Sequences of 60 New cDNA Clones from Brain which Code for Large Proteins. DNA Res. 8, 179-187.