Incidental Mutation 'R7554:Nphp3'
ID584627
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7554 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104042071 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1306 (D1306V)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774] [ENSMUST00000216593]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035167
AA Change: D1306V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: D1306V

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: D1186V
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: D1186V

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216593
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,485 F185I probably damaging Het
Abi3bp T A 16: 56,618,212 probably null Het
Acot5 T A 12: 84,073,480 L203H probably damaging Het
Alad C T 4: 62,511,786 probably null Het
Alkbh5 C T 11: 60,538,589 T56I probably benign Het
Apbb1ip G A 2: 22,823,546 D138N unknown Het
BC049715 T G 6: 136,840,297 S178R probably damaging Het
C1rb C A 6: 124,580,406 H501N probably damaging Het
Celsr3 A T 9: 108,841,209 M2327L probably benign Het
Cers4 G A 8: 4,515,718 V55I probably benign Het
Cngb3 A T 4: 19,461,753 K545* probably null Het
Crb1 C T 1: 139,337,281 C133Y probably damaging Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Cyp7b1 C T 3: 18,097,446 G201D probably benign Het
Dcun1d2 A T 8: 13,281,077 C18S probably benign Het
Ddx39b A T 17: 35,247,030 I176F probably benign Het
Dnah7a A G 1: 53,528,698 I1913T possibly damaging Het
Eif2ak1 T C 5: 143,879,478 I198T probably damaging Het
Esp34 G A 17: 38,555,891 M75I probably benign Het
Fam98a G T 17: 75,547,675 C46* probably null Het
Fanci A T 7: 79,412,752 N342I probably damaging Het
Fat1 A T 8: 45,037,165 I3705F possibly damaging Het
Fbxw7 T A 3: 84,976,313 V598D Het
Gas2l2 G A 11: 83,424,410 Q306* probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gigyf2 T A 1: 87,407,570 S378T unknown Het
Hao1 C T 2: 134,530,618 V157M possibly damaging Het
Hdlbp C T 1: 93,437,309 V79M probably damaging Het
Htt G A 5: 34,864,740 R1676H probably damaging Het
Klhl11 A G 11: 100,463,948 V349A probably benign Het
Lama2 T C 10: 27,155,496 E1522G probably damaging Het
Map3k4 T A 17: 12,232,413 K1531M probably damaging Het
Map3k4 T A 17: 12,232,414 K1531* probably null Het
Mapk15 A G 15: 75,995,896 Y120C possibly damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mgat4d A C 8: 83,355,773 K117N probably benign Het
Mid1 G T X: 169,986,014 S468I possibly damaging Het
Mmp8 T C 9: 7,563,111 L225P probably damaging Het
Mrps31 A G 8: 22,421,429 K229R possibly damaging Het
Muc5b A T 7: 141,858,776 T1820S unknown Het
Myof T C 19: 37,954,510 T707A probably benign Het
Nckap5l A T 15: 99,429,380 S143T probably benign Het
Notch3 A G 17: 32,122,371 S2136P probably benign Het
Olfr1118 T A 2: 87,309,005 M92K probably damaging Het
Olfr178 T C 16: 58,889,406 I271M probably benign Het
Olfr22-ps1 C T 11: 73,954,804 T38I probably damaging Het
Olfr521 T A 7: 99,768,003 N280K possibly damaging Het
Olfr657 T C 7: 104,636,526 M284T probably benign Het
Olfr664 T C 7: 104,733,867 I166V probably benign Het
Pabpc4l T A 3: 46,447,114 T32S probably benign Het
Papd7 G T 13: 69,500,072 H734Q probably damaging Het
Pcdhb10 A C 18: 37,411,882 T4P probably benign Het
Pkhd1l1 A G 15: 44,495,470 I358M probably damaging Het
Plekhg1 A G 10: 3,963,647 E1178G Het
Prkcd A T 14: 30,609,263 Y52N probably damaging Het
Rasa3 G A 8: 13,595,390 T183M probably damaging Het
Rbm26 G T 14: 105,160,593 A31D unknown Het
Scara3 T C 14: 65,920,850 T570A possibly damaging Het
Sec24d T A 3: 123,355,774 V810D probably damaging Het
Sgcz A T 8: 37,563,272 probably null Het
Stt3b A G 9: 115,280,409 probably null Het
Synpo G T 18: 60,603,333 Q514K probably benign Het
Tagln2 G T 1: 172,505,844 K88N probably damaging Het
Tcaf1 T A 6: 42,677,454 K601N probably benign Het
Tprn T C 2: 25,263,799 F371S probably damaging Het
Ttc26 T A 6: 38,385,500 L70Q probably null Het
Ttn A T 2: 76,841,308 V11304E unknown Het
Ttn C T 2: 76,875,863 W9171* probably null Het
Vmn2r50 A T 7: 10,050,139 M136K probably null Het
Zfp518b G A 5: 38,673,072 P530L probably damaging Het
Zfp941 C A 7: 140,812,057 S463I possibly damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACCTTGATGGCTACTTAG -3'
(R):5'- ACTTGACACGACAATTCAATGC -3'

Sequencing Primer
(F):5'- CACCTTGATGGCTACTTAGAAGCAAG -3'
(R):5'- TTGACACGACAATTCAATGCAACTC -3'
Posted On2019-10-17