Incidental Mutation 'R7554:Stt3b'
ID584629
Institutional Source Beutler Lab
Gene Symbol Stt3b
Ensembl Gene ENSMUSG00000032437
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms1300006C19Rik, Simp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R7554 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location115242581-115310421 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 115280409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035010] [ENSMUST00000035010]
Predicted Effect probably null
Transcript: ENSMUST00000035010
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035010
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of a protein complex that transfers oligosaccharides onto asparagine residues. Defects in this gene are a cause of congenital disorder of glycosylation Ix (CDG1X). [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,485 F185I probably damaging Het
Abi3bp T A 16: 56,618,212 probably null Het
Acot5 T A 12: 84,073,480 L203H probably damaging Het
Alad C T 4: 62,511,786 probably null Het
Alkbh5 C T 11: 60,538,589 T56I probably benign Het
Apbb1ip G A 2: 22,823,546 D138N unknown Het
BC049715 T G 6: 136,840,297 S178R probably damaging Het
C1rb C A 6: 124,580,406 H501N probably damaging Het
Celsr3 A T 9: 108,841,209 M2327L probably benign Het
Cers4 G A 8: 4,515,718 V55I probably benign Het
Cngb3 A T 4: 19,461,753 K545* probably null Het
Crb1 C T 1: 139,337,281 C133Y probably damaging Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Cyp7b1 C T 3: 18,097,446 G201D probably benign Het
Dcun1d2 A T 8: 13,281,077 C18S probably benign Het
Ddx39b A T 17: 35,247,030 I176F probably benign Het
Dnah7a A G 1: 53,528,698 I1913T possibly damaging Het
Eif2ak1 T C 5: 143,879,478 I198T probably damaging Het
Esp34 G A 17: 38,555,891 M75I probably benign Het
Fam98a G T 17: 75,547,675 C46* probably null Het
Fanci A T 7: 79,412,752 N342I probably damaging Het
Fat1 A T 8: 45,037,165 I3705F possibly damaging Het
Fbxw7 T A 3: 84,976,313 V598D Het
Gas2l2 G A 11: 83,424,410 Q306* probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gigyf2 T A 1: 87,407,570 S378T unknown Het
Hao1 C T 2: 134,530,618 V157M possibly damaging Het
Hdlbp C T 1: 93,437,309 V79M probably damaging Het
Htt G A 5: 34,864,740 R1676H probably damaging Het
Klhl11 A G 11: 100,463,948 V349A probably benign Het
Lama2 T C 10: 27,155,496 E1522G probably damaging Het
Map3k4 T A 17: 12,232,413 K1531M probably damaging Het
Map3k4 T A 17: 12,232,414 K1531* probably null Het
Mapk15 A G 15: 75,995,896 Y120C possibly damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mgat4d A C 8: 83,355,773 K117N probably benign Het
Mid1 G T X: 169,986,014 S468I possibly damaging Het
Mmp8 T C 9: 7,563,111 L225P probably damaging Het
Mrps31 A G 8: 22,421,429 K229R possibly damaging Het
Muc5b A T 7: 141,858,776 T1820S unknown Het
Myof T C 19: 37,954,510 T707A probably benign Het
Nckap5l A T 15: 99,429,380 S143T probably benign Het
Notch3 A G 17: 32,122,371 S2136P probably benign Het
Nphp3 A T 9: 104,042,071 D1306V probably damaging Het
Olfr1118 T A 2: 87,309,005 M92K probably damaging Het
Olfr178 T C 16: 58,889,406 I271M probably benign Het
Olfr22-ps1 C T 11: 73,954,804 T38I probably damaging Het
Olfr521 T A 7: 99,768,003 N280K possibly damaging Het
Olfr657 T C 7: 104,636,526 M284T probably benign Het
Olfr664 T C 7: 104,733,867 I166V probably benign Het
Pabpc4l T A 3: 46,447,114 T32S probably benign Het
Papd7 G T 13: 69,500,072 H734Q probably damaging Het
Pcdhb10 A C 18: 37,411,882 T4P probably benign Het
Pkhd1l1 A G 15: 44,495,470 I358M probably damaging Het
Plekhg1 A G 10: 3,963,647 E1178G Het
Prkcd A T 14: 30,609,263 Y52N probably damaging Het
Rasa3 G A 8: 13,595,390 T183M probably damaging Het
Rbm26 G T 14: 105,160,593 A31D unknown Het
Scara3 T C 14: 65,920,850 T570A possibly damaging Het
Sec24d T A 3: 123,355,774 V810D probably damaging Het
Sgcz A T 8: 37,563,272 probably null Het
Synpo G T 18: 60,603,333 Q514K probably benign Het
Tagln2 G T 1: 172,505,844 K88N probably damaging Het
Tcaf1 T A 6: 42,677,454 K601N probably benign Het
Tprn T C 2: 25,263,799 F371S probably damaging Het
Ttc26 T A 6: 38,385,500 L70Q probably null Het
Ttn A T 2: 76,841,308 V11304E unknown Het
Ttn C T 2: 76,875,863 W9171* probably null Het
Vmn2r50 A T 7: 10,050,139 M136K probably null Het
Zfp518b G A 5: 38,673,072 P530L probably damaging Het
Zfp941 C A 7: 140,812,057 S463I possibly damaging Het
Other mutations in Stt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Stt3b APN 9 115251847 missense probably benign 0.42
IGL00929:Stt3b APN 9 115266165 missense probably damaging 1.00
IGL01333:Stt3b APN 9 115257544 missense probably damaging 0.97
IGL01389:Stt3b APN 9 115253900 missense probably benign
IGL01680:Stt3b APN 9 115246261 splice site probably benign
IGL01980:Stt3b APN 9 115276699 splice site probably null
IGL02351:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02358:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02421:Stt3b APN 9 115251852 splice site probably benign
IGL02602:Stt3b APN 9 115276778 missense probably damaging 1.00
IGL03231:Stt3b APN 9 115243994 missense unknown
supersonic UTSW 9 115254017 missense probably damaging 1.00
R0482:Stt3b UTSW 9 115248567 missense probably benign 0.10
R1221:Stt3b UTSW 9 115257499 missense probably benign 0.00
R1437:Stt3b UTSW 9 115254927 missense probably damaging 1.00
R1477:Stt3b UTSW 9 115266192 missense probably damaging 1.00
R1604:Stt3b UTSW 9 115250927 missense probably damaging 1.00
R1796:Stt3b UTSW 9 115248607 nonsense probably null
R4112:Stt3b UTSW 9 115266138 missense probably damaging 1.00
R4166:Stt3b UTSW 9 115254901 missense probably damaging 1.00
R4695:Stt3b UTSW 9 115254794 missense probably damaging 1.00
R5183:Stt3b UTSW 9 115266143 missense probably damaging 0.99
R5317:Stt3b UTSW 9 115252510 nonsense probably null
R5631:Stt3b UTSW 9 115254845 missense probably benign 0.05
R5665:Stt3b UTSW 9 115266147 missense probably damaging 1.00
R6495:Stt3b UTSW 9 115267320 missense possibly damaging 0.46
R6517:Stt3b UTSW 9 115267342 missense probably benign
R6525:Stt3b UTSW 9 115258558 missense probably damaging 1.00
R6593:Stt3b UTSW 9 115252511 missense probably damaging 0.99
R7065:Stt3b UTSW 9 115266156 missense probably damaging 1.00
R7071:Stt3b UTSW 9 115254017 missense probably damaging 1.00
R7297:Stt3b UTSW 9 115276957 missense probably damaging 1.00
R7313:Stt3b UTSW 9 115266115 missense probably damaging 0.99
R7790:Stt3b UTSW 9 115276819 missense probably damaging 1.00
R7802:Stt3b UTSW 9 115276881 missense probably damaging 1.00
R8305:Stt3b UTSW 9 115254931 missense probably damaging 1.00
R8361:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8362:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8363:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8371:Stt3b UTSW 9 115266175 missense probably damaging 1.00
R8799:Stt3b UTSW 9 115248617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCAGTGTAAGATATCCTAC -3'
(R):5'- AGGGACTTGCTTCACAGTTCTC -3'

Sequencing Primer
(F):5'- TATCCTACAAATAAACTGCCAAGAGC -3'
(R):5'- CTCTTCATAGTGAGATATGTGTAGCC -3'
Posted On2019-10-17