Incidental Mutation 'R7554:Lama2'
ID584631
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R7554 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27155496 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1522 (E1522G)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000092639
AA Change: E1522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: E1522G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,485 F185I probably damaging Het
Abi3bp T A 16: 56,618,212 probably null Het
Acot5 T A 12: 84,073,480 L203H probably damaging Het
Alad C T 4: 62,511,786 probably null Het
Alkbh5 C T 11: 60,538,589 T56I probably benign Het
Apbb1ip G A 2: 22,823,546 D138N unknown Het
BC049715 T G 6: 136,840,297 S178R probably damaging Het
C1rb C A 6: 124,580,406 H501N probably damaging Het
Celsr3 A T 9: 108,841,209 M2327L probably benign Het
Cers4 G A 8: 4,515,718 V55I probably benign Het
Cngb3 A T 4: 19,461,753 K545* probably null Het
Crb1 C T 1: 139,337,281 C133Y probably damaging Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Cyp7b1 C T 3: 18,097,446 G201D probably benign Het
Dcun1d2 A T 8: 13,281,077 C18S probably benign Het
Ddx39b A T 17: 35,247,030 I176F probably benign Het
Dnah7a A G 1: 53,528,698 I1913T possibly damaging Het
Eif2ak1 T C 5: 143,879,478 I198T probably damaging Het
Esp34 G A 17: 38,555,891 M75I probably benign Het
Fam98a G T 17: 75,547,675 C46* probably null Het
Fanci A T 7: 79,412,752 N342I probably damaging Het
Fat1 A T 8: 45,037,165 I3705F possibly damaging Het
Fbxw7 T A 3: 84,976,313 V598D Het
Gas2l2 G A 11: 83,424,410 Q306* probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gigyf2 T A 1: 87,407,570 S378T unknown Het
Hao1 C T 2: 134,530,618 V157M possibly damaging Het
Hdlbp C T 1: 93,437,309 V79M probably damaging Het
Htt G A 5: 34,864,740 R1676H probably damaging Het
Klhl11 A G 11: 100,463,948 V349A probably benign Het
Map3k4 T A 17: 12,232,413 K1531M probably damaging Het
Map3k4 T A 17: 12,232,414 K1531* probably null Het
Mapk15 A G 15: 75,995,896 Y120C possibly damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mgat4d A C 8: 83,355,773 K117N probably benign Het
Mid1 G T X: 169,986,014 S468I possibly damaging Het
Mmp8 T C 9: 7,563,111 L225P probably damaging Het
Mrps31 A G 8: 22,421,429 K229R possibly damaging Het
Muc5b A T 7: 141,858,776 T1820S unknown Het
Myof T C 19: 37,954,510 T707A probably benign Het
Nckap5l A T 15: 99,429,380 S143T probably benign Het
Notch3 A G 17: 32,122,371 S2136P probably benign Het
Nphp3 A T 9: 104,042,071 D1306V probably damaging Het
Olfr1118 T A 2: 87,309,005 M92K probably damaging Het
Olfr178 T C 16: 58,889,406 I271M probably benign Het
Olfr22-ps1 C T 11: 73,954,804 T38I probably damaging Het
Olfr521 T A 7: 99,768,003 N280K possibly damaging Het
Olfr657 T C 7: 104,636,526 M284T probably benign Het
Olfr664 T C 7: 104,733,867 I166V probably benign Het
Pabpc4l T A 3: 46,447,114 T32S probably benign Het
Papd7 G T 13: 69,500,072 H734Q probably damaging Het
Pcdhb10 A C 18: 37,411,882 T4P probably benign Het
Pkhd1l1 A G 15: 44,495,470 I358M probably damaging Het
Plekhg1 A G 10: 3,963,647 E1178G Het
Prkcd A T 14: 30,609,263 Y52N probably damaging Het
Rasa3 G A 8: 13,595,390 T183M probably damaging Het
Rbm26 G T 14: 105,160,593 A31D unknown Het
Scara3 T C 14: 65,920,850 T570A possibly damaging Het
Sec24d T A 3: 123,355,774 V810D probably damaging Het
Sgcz A T 8: 37,563,272 probably null Het
Stt3b A G 9: 115,280,409 probably null Het
Synpo G T 18: 60,603,333 Q514K probably benign Het
Tagln2 G T 1: 172,505,844 K88N probably damaging Het
Tcaf1 T A 6: 42,677,454 K601N probably benign Het
Tprn T C 2: 25,263,799 F371S probably damaging Het
Ttc26 T A 6: 38,385,500 L70Q probably null Het
Ttn A T 2: 76,841,308 V11304E unknown Het
Ttn C T 2: 76,875,863 W9171* probably null Het
Vmn2r50 A T 7: 10,050,139 M136K probably null Het
Zfp518b G A 5: 38,673,072 P530L probably damaging Het
Zfp941 C A 7: 140,812,057 S463I possibly damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7168:Lama2 UTSW 10 27366152 critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7569:Lama2 UTSW 10 27265050 missense probably damaging 1.00
R7574:Lama2 UTSW 10 27006730 missense probably benign 0.03
R7584:Lama2 UTSW 10 27104261 missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27101393 missense probably benign 0.00
R7603:Lama2 UTSW 10 27266680 missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27208393 missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26990924 missense probably damaging 0.97
R7841:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7864:Lama2 UTSW 10 27056615 missense probably benign 0.08
R7960:Lama2 UTSW 10 26993098 missense probably benign 0.04
R7964:Lama2 UTSW 10 27223981 critical splice donor site probably null
R7980:Lama2 UTSW 10 27363613 missense probably damaging 0.98
R8013:Lama2 UTSW 10 27344498 missense probably benign 0.00
R8028:Lama2 UTSW 10 27328149 missense probably benign 0.13
R8097:Lama2 UTSW 10 27190664 nonsense probably null
R8100:Lama2 UTSW 10 27041117 missense probably benign 0.03
R8110:Lama2 UTSW 10 26990870 missense probably damaging 1.00
R8122:Lama2 UTSW 10 27054596 missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27467222 missense probably benign 0.07
R8315:Lama2 UTSW 10 27422659 missense probably damaging 1.00
R8318:Lama2 UTSW 10 26984338 missense probably damaging 1.00
R8419:Lama2 UTSW 10 27422563 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTTGCTTAGCGGGAGGGAAAC -3'
(R):5'- TCACATGCAAGACCTGAGGC -3'

Sequencing Primer
(F):5'- CTTGTAGGAACTGAGACAGACATG -3'
(R):5'- TGAGGCGCAATCCCTAGTAATACATG -3'
Posted On2019-10-17