Incidental Mutation 'R7554:Esp34'
ID584651
Institutional Source Beutler Lab
Gene Symbol Esp34
Ensembl Gene ENSMUSG00000092244
Gene Nameexocrine gland secreted peptide 34
SynonymsGm20410
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7554 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38554192-38560621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38555891 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 75 (M75I)
Ref Sequence ENSEMBL: ENSMUSP00000133675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173055] [ENSMUST00000178654]
Predicted Effect probably benign
Transcript: ENSMUST00000173055
AA Change: M75I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133675
Gene: ENSMUSG00000092244
AA Change: M75I

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:ESP 92 147 9.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178654
AA Change: M7I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136619
Gene: ENSMUSG00000092244
AA Change: M7I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 77 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,485 F185I probably damaging Het
Abi3bp T A 16: 56,618,212 probably null Het
Acot5 T A 12: 84,073,480 L203H probably damaging Het
Alad C T 4: 62,511,786 probably null Het
Alkbh5 C T 11: 60,538,589 T56I probably benign Het
Apbb1ip G A 2: 22,823,546 D138N unknown Het
BC049715 T G 6: 136,840,297 S178R probably damaging Het
C1rb C A 6: 124,580,406 H501N probably damaging Het
Celsr3 A T 9: 108,841,209 M2327L probably benign Het
Cers4 G A 8: 4,515,718 V55I probably benign Het
Cngb3 A T 4: 19,461,753 K545* probably null Het
Crb1 C T 1: 139,337,281 C133Y probably damaging Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Cyp7b1 C T 3: 18,097,446 G201D probably benign Het
Dcun1d2 A T 8: 13,281,077 C18S probably benign Het
Ddx39b A T 17: 35,247,030 I176F probably benign Het
Dnah7a A G 1: 53,528,698 I1913T possibly damaging Het
Eif2ak1 T C 5: 143,879,478 I198T probably damaging Het
Fam98a G T 17: 75,547,675 C46* probably null Het
Fanci A T 7: 79,412,752 N342I probably damaging Het
Fat1 A T 8: 45,037,165 I3705F possibly damaging Het
Fbxw7 T A 3: 84,976,313 V598D Het
Gas2l2 G A 11: 83,424,410 Q306* probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gigyf2 T A 1: 87,407,570 S378T unknown Het
Hao1 C T 2: 134,530,618 V157M possibly damaging Het
Hdlbp C T 1: 93,437,309 V79M probably damaging Het
Htt G A 5: 34,864,740 R1676H probably damaging Het
Klhl11 A G 11: 100,463,948 V349A probably benign Het
Lama2 T C 10: 27,155,496 E1522G probably damaging Het
Map3k4 T A 17: 12,232,413 K1531M probably damaging Het
Map3k4 T A 17: 12,232,414 K1531* probably null Het
Mapk15 A G 15: 75,995,896 Y120C possibly damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mgat4d A C 8: 83,355,773 K117N probably benign Het
Mid1 G T X: 169,986,014 S468I possibly damaging Het
Mmp8 T C 9: 7,563,111 L225P probably damaging Het
Mrps31 A G 8: 22,421,429 K229R possibly damaging Het
Muc5b A T 7: 141,858,776 T1820S unknown Het
Myof T C 19: 37,954,510 T707A probably benign Het
Nckap5l A T 15: 99,429,380 S143T probably benign Het
Notch3 A G 17: 32,122,371 S2136P probably benign Het
Nphp3 A T 9: 104,042,071 D1306V probably damaging Het
Olfr1118 T A 2: 87,309,005 M92K probably damaging Het
Olfr178 T C 16: 58,889,406 I271M probably benign Het
Olfr22-ps1 C T 11: 73,954,804 T38I probably damaging Het
Olfr521 T A 7: 99,768,003 N280K possibly damaging Het
Olfr657 T C 7: 104,636,526 M284T probably benign Het
Olfr664 T C 7: 104,733,867 I166V probably benign Het
Pabpc4l T A 3: 46,447,114 T32S probably benign Het
Papd7 G T 13: 69,500,072 H734Q probably damaging Het
Pcdhb10 A C 18: 37,411,882 T4P probably benign Het
Pkhd1l1 A G 15: 44,495,470 I358M probably damaging Het
Plekhg1 A G 10: 3,963,647 E1178G Het
Prkcd A T 14: 30,609,263 Y52N probably damaging Het
Rasa3 G A 8: 13,595,390 T183M probably damaging Het
Rbm26 G T 14: 105,160,593 A31D unknown Het
Scara3 T C 14: 65,920,850 T570A possibly damaging Het
Sec24d T A 3: 123,355,774 V810D probably damaging Het
Sgcz A T 8: 37,563,272 probably null Het
Stt3b A G 9: 115,280,409 probably null Het
Synpo G T 18: 60,603,333 Q514K probably benign Het
Tagln2 G T 1: 172,505,844 K88N probably damaging Het
Tcaf1 T A 6: 42,677,454 K601N probably benign Het
Tprn T C 2: 25,263,799 F371S probably damaging Het
Ttc26 T A 6: 38,385,500 L70Q probably null Het
Ttn A T 2: 76,841,308 V11304E unknown Het
Ttn C T 2: 76,875,863 W9171* probably null Het
Vmn2r50 A T 7: 10,050,139 M136K probably null Het
Zfp518b G A 5: 38,673,072 P530L probably damaging Het
Zfp941 C A 7: 140,812,057 S463I possibly damaging Het
Other mutations in Esp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1479:Esp34 UTSW 17 38554328 utr 5 prime probably benign
R1854:Esp34 UTSW 17 38559533 missense possibly damaging 0.85
R3908:Esp34 UTSW 17 38559641 missense possibly damaging 0.92
R4013:Esp34 UTSW 17 38559555 nonsense probably null
R4392:Esp34 UTSW 17 38559491 missense possibly damaging 0.51
R6008:Esp34 UTSW 17 38554227 utr 5 prime probably benign
R7522:Esp34 UTSW 17 38559541 missense possibly damaging 0.71
R7532:Esp34 UTSW 17 38559620 missense possibly damaging 0.93
R7686:Esp34 UTSW 17 38559643 missense possibly damaging 0.71
R8008:Esp34 UTSW 17 38559599 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCTGTTAGAGTCAAGGTTGGC -3'
(R):5'- GTGGACAGTGCAAACCTATTC -3'

Sequencing Primer
(F):5'- TAAACCTACAGTGACCCTACTTGGTG -3'
(R):5'- CAGTGCAAACCTATTCTCCTATAAC -3'
Posted On2019-10-17