Incidental Mutation 'R7554:Myof'
ID584655
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7554 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37954510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 707 (T707A)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect probably benign
Transcript: ENSMUST00000041475
AA Change: T707A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: T707A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172095
AA Change: T707A

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: T707A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225159
AA Change: T191A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000226068
AA Change: T720A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,485 F185I probably damaging Het
Abi3bp T A 16: 56,618,212 probably null Het
Acot5 T A 12: 84,073,480 L203H probably damaging Het
Alad C T 4: 62,511,786 probably null Het
Alkbh5 C T 11: 60,538,589 T56I probably benign Het
Apbb1ip G A 2: 22,823,546 D138N unknown Het
BC049715 T G 6: 136,840,297 S178R probably damaging Het
C1rb C A 6: 124,580,406 H501N probably damaging Het
Celsr3 A T 9: 108,841,209 M2327L probably benign Het
Cers4 G A 8: 4,515,718 V55I probably benign Het
Cngb3 A T 4: 19,461,753 K545* probably null Het
Crb1 C T 1: 139,337,281 C133Y probably damaging Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Cyp7b1 C T 3: 18,097,446 G201D probably benign Het
Dcun1d2 A T 8: 13,281,077 C18S probably benign Het
Ddx39b A T 17: 35,247,030 I176F probably benign Het
Dnah7a A G 1: 53,528,698 I1913T possibly damaging Het
Eif2ak1 T C 5: 143,879,478 I198T probably damaging Het
Esp34 G A 17: 38,555,891 M75I probably benign Het
Fam98a G T 17: 75,547,675 C46* probably null Het
Fanci A T 7: 79,412,752 N342I probably damaging Het
Fat1 A T 8: 45,037,165 I3705F possibly damaging Het
Fbxw7 T A 3: 84,976,313 V598D Het
Gas2l2 G A 11: 83,424,410 Q306* probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gigyf2 T A 1: 87,407,570 S378T unknown Het
Hao1 C T 2: 134,530,618 V157M possibly damaging Het
Hdlbp C T 1: 93,437,309 V79M probably damaging Het
Htt G A 5: 34,864,740 R1676H probably damaging Het
Klhl11 A G 11: 100,463,948 V349A probably benign Het
Lama2 T C 10: 27,155,496 E1522G probably damaging Het
Map3k4 T A 17: 12,232,413 K1531M probably damaging Het
Map3k4 T A 17: 12,232,414 K1531* probably null Het
Mapk15 A G 15: 75,995,896 Y120C possibly damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mgat4d A C 8: 83,355,773 K117N probably benign Het
Mid1 G T X: 169,986,014 S468I possibly damaging Het
Mmp8 T C 9: 7,563,111 L225P probably damaging Het
Mrps31 A G 8: 22,421,429 K229R possibly damaging Het
Muc5b A T 7: 141,858,776 T1820S unknown Het
Nckap5l A T 15: 99,429,380 S143T probably benign Het
Notch3 A G 17: 32,122,371 S2136P probably benign Het
Nphp3 A T 9: 104,042,071 D1306V probably damaging Het
Olfr1118 T A 2: 87,309,005 M92K probably damaging Het
Olfr178 T C 16: 58,889,406 I271M probably benign Het
Olfr22-ps1 C T 11: 73,954,804 T38I probably damaging Het
Olfr521 T A 7: 99,768,003 N280K possibly damaging Het
Olfr657 T C 7: 104,636,526 M284T probably benign Het
Olfr664 T C 7: 104,733,867 I166V probably benign Het
Pabpc4l T A 3: 46,447,114 T32S probably benign Het
Papd7 G T 13: 69,500,072 H734Q probably damaging Het
Pcdhb10 A C 18: 37,411,882 T4P probably benign Het
Pkhd1l1 A G 15: 44,495,470 I358M probably damaging Het
Plekhg1 A G 10: 3,963,647 E1178G Het
Prkcd A T 14: 30,609,263 Y52N probably damaging Het
Rasa3 G A 8: 13,595,390 T183M probably damaging Het
Rbm26 G T 14: 105,160,593 A31D unknown Het
Scara3 T C 14: 65,920,850 T570A possibly damaging Het
Sec24d T A 3: 123,355,774 V810D probably damaging Het
Sgcz A T 8: 37,563,272 probably null Het
Stt3b A G 9: 115,280,409 probably null Het
Synpo G T 18: 60,603,333 Q514K probably benign Het
Tagln2 G T 1: 172,505,844 K88N probably damaging Het
Tcaf1 T A 6: 42,677,454 K601N probably benign Het
Tprn T C 2: 25,263,799 F371S probably damaging Het
Ttc26 T A 6: 38,385,500 L70Q probably null Het
Ttn A T 2: 76,841,308 V11304E unknown Het
Ttn C T 2: 76,875,863 W9171* probably null Het
Vmn2r50 A T 7: 10,050,139 M136K probably null Het
Zfp518b G A 5: 38,673,072 P530L probably damaging Het
Zfp941 C A 7: 140,812,057 S463I possibly damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTCGCAGATATACCAGATGACCC -3'
(R):5'- ATCTACGTGAAATGGCGTGC -3'

Sequencing Primer
(F):5'- ACCCTTCTTGTCATCTGCAGAATC -3'
(R):5'- TGGCGTGCAGACATACATTAAAC -3'
Posted On2019-10-17