Mutagenetix > Incidental Mutation

Incidental Mutation 'R7555:Eif2ak4'

584668

Institutional Source

Beutler Lab

Gene Symbol

Eif2ak4

Ensembl Gene

ENSMUSG00000005102

Gene Name

eukaryotic translation initiation factor 2 alpha kinase 4

Synonyms

GCN2

MMRRC Submission

Accession Numbers

MGI: 1353427

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7555 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118388618-118475234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118417283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 267 (I267N)

Ref Sequence

ENSEMBL: ENSMUSP00000005233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005233
AA Change: I267N

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: I267N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	4.6e-27	PFAM
Pfam:Pkinase_Tyr	326	535	5.5e-18	PFAM
Pfam:Pkinase	589	663	1.7e-11	PFAM
Pfam:Pkinase_Tyr	589	663	1.2e-5	PFAM
low complexity region	728	738	N/A	INTRINSIC
Pfam:Pkinase	781	1000	2.6e-38	PFAM
Pfam:Pkinase_Tyr	786	998	1.8e-18	PFAM
Pfam:tRNA-synt_His	1054	1380	5.7e-18	PFAM
Pfam:HGTP_anticodon2	1392	1647	5.8e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102527
AA Change: I155N

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: I155N

Domain	Start	End	E-Value	Type
coiled coil region	34	93	N/A	INTRINSIC
Pfam:Pkinase	211	426	1.6e-22	PFAM
Pfam:Pkinase_Tyr	215	423	6.8e-18	PFAM
Pfam:Pkinase_Tyr	477	551	1.2e-5	PFAM
Pfam:Pkinase	477	552	3.9e-11	PFAM
low complexity region	616	626	N/A	INTRINSIC
Pfam:Pkinase	647	888	9.4e-42	PFAM
Pfam:Pkinase_Tyr	672	886	1.4e-19	PFAM
Pfam:tRNA-synt_His	941	1268	4.8e-19	PFAM
Pfam:HGTP_anticodon2	1280	1535	1e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110870

SMART Domains

Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102

Domain	Start	End	E-Value	Type
Pfam:Pkinase	45	260	3.3e-22	PFAM
Pfam:Pkinase_Tyr	47	257	1.3e-17	PFAM
Pfam:Pkinase_Tyr	311	385	2.5e-5	PFAM
Pfam:Pkinase	311	386	8e-11	PFAM
low complexity region	450	460	N/A	INTRINSIC
Pfam:Pkinase	481	722	1.9e-41	PFAM
Pfam:Pkinase_Tyr	506	720	2.8e-19	PFAM
Pfam:tRNA-synt_His	775	1102	8.7e-19	PFAM
Pfam:HGTP_anticodon2	1114	1369	1.9e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110872
AA Change: I146N

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: I146N

Domain	Start	End	E-Value	Type
coiled coil region	25	84	N/A	INTRINSIC
Pfam:Pkinase	202	417	3.8e-22	PFAM
Pfam:Pkinase_Tyr	206	414	1.6e-17	PFAM
Pfam:Pkinase_Tyr	468	542	2.8e-5	PFAM
Pfam:Pkinase	468	543	9.1e-11	PFAM
low complexity region	607	617	N/A	INTRINSIC
Pfam:Pkinase	638	879	2.2e-41	PFAM
Pfam:Pkinase_Tyr	663	877	3.3e-19	PFAM
Pfam:tRNA-synt_His	932	1259	1.1e-18	PFAM
Pfam:HGTP_anticodon2	1271	1526	2.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110874
AA Change: I189N

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: I189N

Domain	Start	End	E-Value	Type
Pfam:RWD	8	56	6.4e-8	PFAM
coiled coil region	68	127	N/A	INTRINSIC
Pfam:Pkinase	245	460	1.1e-22	PFAM
Pfam:Pkinase_Tyr	247	457	4.2e-18	PFAM
Pfam:Pkinase_Tyr	511	585	7.8e-6	PFAM
Pfam:Pkinase	511	586	2.5e-11	PFAM
low complexity region	650	660	N/A	INTRINSIC
Pfam:Pkinase	681	922	6.2e-42	PFAM
Pfam:Pkinase_Tyr	706	920	9.3e-20	PFAM
Pfam:tRNA-synt_His	975	1302	3.8e-19	PFAM
Pfam:HGTP_anticodon2	1314	1569	5.4e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110877
AA Change: I267N

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: I267N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	2.6e-23	PFAM
Pfam:Pkinase_Tyr	327	535	1.1e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,522,354	I97N	probably damaging	Het
Acvrl1	A	G	15: 101,143,473	H502R	probably benign	Het
Adgrf4	T	C	17: 42,672,603	S63G	probably benign	Het
Agbl2	C	A	2: 90,791,555	L129I	probably damaging	Het
Ankrd11	C	A	8: 122,887,406	A2542S	probably damaging	Het
Armc9	A	G	1: 86,275,678	K818R	probably damaging	Het
Arsj	T	A	3: 126,438,236	C210*	probably null	Het
Aspscr1	C	T	11: 120,673,100	A11V	unknown	Het
Bicc1	G	T	10: 70,956,291	Q296K	possibly damaging	Het
Borcs5	A	C	6: 134,685,979	Q73P	probably benign	Het
Capn15	G	T	17: 25,963,432	D567E	probably damaging	Het
Catsperg1	A	C	7: 29,189,814	I866S	probably damaging	Het
Ccdc27	G	T	4: 154,041,817	H72N	unknown	Het
Ccser2	A	T	14: 36,879,500	M309K	possibly damaging	Het
Cd1d2	A	G	3: 86,987,101	S59G	probably benign	Het
Chml	G	A	1: 175,687,890	P155L	probably benign	Het
Csmd2	C	T	4: 128,452,458	P1504S		Het
Dcbld2	A	G	16: 58,448,718		probably null	Het
Ddx21	C	T	10: 62,598,243	E246K	probably benign	Het
Dhx29	C	T	13: 112,927,642		probably benign	Het
Dis3l	A	C	9: 64,311,937	Y570*	probably null	Het
Dnah14	T	A	1: 181,770,054	Y3623N	probably benign	Het
Dock8	A	G	19: 25,175,400	D1610G	probably damaging	Het
Dync1h1	T	C	12: 110,630,625	S1669P	probably benign	Het
Ern2	A	T	7: 122,170,241	V854E	probably damaging	Het
Fuca2	G	A	10: 13,507,430		probably null	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gm1110	T	A	9: 26,893,628	T380S	probably benign	Het
Gm13128	T	C	4: 144,332,741	F341L	probably benign	Het
Gm5788	A	C	12: 87,494,735	K5N	unknown	Het
Gm6460	A	T	5: 11,597,612	N106Y	probably damaging	Het
Golga2	G	A	2: 32,288,166	R29H	probably benign	Het
Grik5	T	C	7: 25,060,597	E259G	probably benign	Het
Grm3	T	C	5: 9,570,000	T415A	probably benign	Het
Gtf3c1	A	G	7: 125,645,670	Y1731H	probably damaging	Het
Hectd2	T	C	19: 36,612,403	C643R	probably damaging	Het
Hgfac	T	C	5: 35,042,628	S118P	probably damaging	Het
Hmcn1	A	G	1: 150,604,874	V4517A	probably benign	Het
Hnrnpc	A	T	14: 52,075,153	L290*	probably null	Het
Homer3	A	G	8: 70,289,413	E108G	probably damaging	Het
Hsd17b3	G	T	13: 64,072,002	S141R	probably benign	Het
Hspa12b	C	T	2: 131,138,476	T105I	probably damaging	Het
Ifi202b	T	C	1: 173,972,221	I231M	probably damaging	Het
Inhba	T	A	13: 16,017,637	N114K	probably benign	Het
Kmt2b	C	A	7: 30,569,410	M2631I	possibly damaging	Het
Loxhd1	C	T	18: 77,395,365	T1214I	probably damaging	Het
Lrp1	G	T	10: 127,546,862	N3683K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,363	K196R	probably benign	Het
Lrrn3	A	T	12: 41,452,911	M469K	probably benign	Het
Mafb	T	C	2: 160,365,829	E283G	probably damaging	Het
Mapt	C	A	11: 104,298,702	P182Q	probably benign	Het
Mmp14	G	T	14: 54,437,742	R277L	possibly damaging	Het
Mucl2	T	A	15: 103,897,445	N82I	probably benign	Het
Nsun6	T	A	2: 14,996,339	T469S	possibly damaging	Het
Olfr1076	A	C	2: 86,509,347	D296A	probably damaging	Het
Olfr1342	T	C	4: 118,689,642	D270G	possibly damaging	Het
Olfr507	G	C	7: 108,622,726	A305P	probably damaging	Het
Osbpl5	A	T	7: 143,694,933	F631I	possibly damaging	Het
Otud3	G	T	4: 138,901,885	D190E	possibly damaging	Het
Pcdhb6	A	T	18: 37,335,279	I418F	possibly damaging	Het
Per1	G	A	11: 69,106,513	R838H	probably damaging	Het
Per2	G	A	1: 91,435,135	P395S	probably damaging	Het
Per3	G	A	4: 151,018,058	Q583*	probably null	Het
Pkhd1l1	A	T	15: 44,550,761	H2808L	possibly damaging	Het
Ppfia2	A	G	10: 106,927,826	T1227A	probably benign	Het
Psg17	C	T	7: 18,817,094	D279N	probably benign	Het
Rnf167	A	G	11: 70,650,797	D235G	probably benign	Het
Rxfp3	A	G	15: 11,036,276	S337P	probably damaging	Het
Sall1	T	C	8: 89,033,158	D106G	possibly damaging	Het
Sema4f	A	G	6: 82,914,056	V590A	probably benign	Het
Setd1b	A	G	5: 123,157,757	D1102G	unknown	Het
Six2	C	A	17: 85,687,707	K82N	probably damaging	Het
Snx29	T	C	16: 11,400,942	M214T	probably benign	Het
Son	T	C	16: 91,658,922	L1519P	probably damaging	Het
Spin1	C	T	13: 51,149,049	S226L	probably benign	Het
Stxbp5l	T	C	16: 37,323,603	D131G	probably damaging	Het
Svep1	T	C	4: 58,069,422	Y2788C	probably damaging	Het
Tbl3	C	A	17: 24,701,976		probably null	Het
Themis	A	T	10: 28,781,702	I242L	possibly damaging	Het
Tmem203	G	A	2: 25,255,730	V21M	probably benign	Het
Trp53inp1	T	C	4: 11,169,750	C171R	probably benign	Het
Tsg101	A	G	7: 46,913,411	Y32H	probably damaging	Het
Tyw1	A	G	5: 130,274,706	D305G	probably damaging	Het
Vmn1r40	A	T	6: 89,715,044	Y281F	probably damaging	Het
Vmn2r105	T	A	17: 20,227,675	T296S	probably damaging	Het
Vmn2r13	T	C	5: 109,171,691		probably null	Het
Zfp933	A	G	4: 147,826,132	F336L	probably damaging	Het

Other mutations in Eif2ak4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Eif2ak4	APN	2	118464055	missense	probably damaging	1.00
IGL00806:Eif2ak4	APN	2	118441166	missense	probably benign	0.08
IGL01343:Eif2ak4	APN	2	118422089	missense	probably benign	0.00
IGL01796:Eif2ak4	APN	2	118446304	missense	probably benign	0.10
IGL02263:Eif2ak4	APN	2	118461778	missense	probably benign	0.00
IGL02391:Eif2ak4	APN	2	118420791	missense	probably benign	0.19
IGL02516:Eif2ak4	APN	2	118436254	missense	probably damaging	1.00
IGL02603:Eif2ak4	APN	2	118450326	missense	probably damaging	1.00
IGL02731:Eif2ak4	APN	2	118388814	missense	probably benign
IGL02928:Eif2ak4	APN	2	118472687	critical splice donor site	probably null
IGL02947:Eif2ak4	APN	2	118431033	missense	probably benign	0.00
IGL03191:Eif2ak4	APN	2	118422212	missense	probably damaging	1.00
IGL03202:Eif2ak4	APN	2	118400620	missense	probably damaging	1.00
IGL03235:Eif2ak4	APN	2	118443140	missense	probably damaging	1.00
IGL03375:Eif2ak4	APN	2	118422318	missense	probably benign	0.08
absurdum	UTSW	2	118420810	nonsense	probably null
Ad	UTSW	2	118436241	missense	probably damaging	1.00
atchoum	UTSW	2	118400653	splice site	probably benign
reductio	UTSW	2	118436158	splice site	probably null
PIT4520001:Eif2ak4	UTSW	2	118462327	missense	probably damaging	1.00
R0023:Eif2ak4	UTSW	2	118462721	missense	probably damaging	1.00
R0358:Eif2ak4	UTSW	2	118463929	splice site	probably null
R0482:Eif2ak4	UTSW	2	118462347	missense	probably damaging	1.00
R0505:Eif2ak4	UTSW	2	118431036	missense	probably benign	0.01
R0523:Eif2ak4	UTSW	2	118442096	critical splice donor site	probably null
R0578:Eif2ak4	UTSW	2	118474991	splice site	probably benign
R0615:Eif2ak4	UTSW	2	118436185	missense	probably damaging	1.00
R1300:Eif2ak4	UTSW	2	118463983	missense	possibly damaging	0.79
R1531:Eif2ak4	UTSW	2	118443210	missense	probably damaging	1.00
R1777:Eif2ak4	UTSW	2	118430839	missense	probably damaging	0.98
R1866:Eif2ak4	UTSW	2	118472661	missense	probably damaging	1.00
R1932:Eif2ak4	UTSW	2	118448486	missense	probably damaging	1.00
R1977:Eif2ak4	UTSW	2	118461757	nonsense	probably null
R2011:Eif2ak4	UTSW	2	118430947	missense	probably damaging	1.00
R2046:Eif2ak4	UTSW	2	118451408	splice site	probably benign
R2122:Eif2ak4	UTSW	2	118455793	missense	probably damaging	1.00
R2125:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2126:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2193:Eif2ak4	UTSW	2	118422266	missense	probably benign	0.12
R2259:Eif2ak4	UTSW	2	118455783	missense	probably damaging	0.97
R2513:Eif2ak4	UTSW	2	118426583	missense	probably damaging	1.00
R3798:Eif2ak4	UTSW	2	118474083	missense	probably damaging	1.00
R3898:Eif2ak4	UTSW	2	118430923	missense	probably damaging	1.00
R3900:Eif2ak4	UTSW	2	118475029	missense	probably damaging	1.00
R4375:Eif2ak4	UTSW	2	118427924	missense	probably damaging	1.00
R4423:Eif2ak4	UTSW	2	118439066	missense	probably benign	0.01
R4589:Eif2ak4	UTSW	2	118417338	missense	probably damaging	1.00
R4734:Eif2ak4	UTSW	2	118422087	missense	probably damaging	1.00
R5173:Eif2ak4	UTSW	2	118408360	missense	probably damaging	1.00
R5367:Eif2ak4	UTSW	2	118436158	splice site	probably null
R5471:Eif2ak4	UTSW	2	118474132	missense	probably benign	0.02
R5528:Eif2ak4	UTSW	2	118427938	missense	probably damaging	1.00
R5634:Eif2ak4	UTSW	2	118462311	missense	probably damaging	1.00
R5726:Eif2ak4	UTSW	2	118443132	missense	probably damaging	1.00
R5756:Eif2ak4	UTSW	2	118462740	missense	possibly damaging	0.95
R5779:Eif2ak4	UTSW	2	118412963	missense	possibly damaging	0.85
R5807:Eif2ak4	UTSW	2	118388851	missense	probably benign
R6045:Eif2ak4	UTSW	2	118388815	nonsense	probably null
R6187:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R6193:Eif2ak4	UTSW	2	118400600	start gained	probably benign
R6468:Eif2ak4	UTSW	2	118436241	missense	probably damaging	1.00
R6555:Eif2ak4	UTSW	2	118427869	missense	probably damaging	0.96
R6616:Eif2ak4	UTSW	2	118454845	nonsense	probably null
R6737:Eif2ak4	UTSW	2	118462268	frame shift	probably null
R6956:Eif2ak4	UTSW	2	118422267	missense	probably damaging	0.96
R7075:Eif2ak4	UTSW	2	118420810	nonsense	probably null
R7109:Eif2ak4	UTSW	2	118405051	missense	probably damaging	1.00
R7228:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R7441:Eif2ak4	UTSW	2	118471896	missense	probably benign	0.01
R7567:Eif2ak4	UTSW	2	118450314	missense	probably benign
R8004:Eif2ak4	UTSW	2	118417294	missense	possibly damaging	0.64
R8063:Eif2ak4	UTSW	2	118410901	missense	possibly damaging	0.94
R8092:Eif2ak4	UTSW	2	118442032	missense	probably damaging	1.00
R8195:Eif2ak4	UTSW	2	118450338	missense	possibly damaging	0.50
R8306:Eif2ak4	UTSW	2	118457175	missense	possibly damaging	0.68
R8470:Eif2ak4	UTSW	2	118462726	missense	probably damaging	0.98
R8671:Eif2ak4	UTSW	2	118422186	missense	possibly damaging	0.88
R8693:Eif2ak4	UTSW	2	118432237	missense	probably damaging	0.98
R8714:Eif2ak4	UTSW	2	118462284	missense	possibly damaging	0.89
R8744:Eif2ak4	UTSW	2	118430993	nonsense	probably null
R8813:Eif2ak4	UTSW	2	118448325	missense	probably damaging	1.00
R8917:Eif2ak4	UTSW	2	118457136	missense	probably damaging	1.00
R8924:Eif2ak4	UTSW	2	118428032	missense	probably damaging	1.00
R9177:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9189:Eif2ak4	UTSW	2	118427912	missense	probably damaging	1.00
R9231:Eif2ak4	UTSW	2	118441181	missense	probably benign	0.00
R9268:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9321:Eif2ak4	UTSW	2	118462317	missense	possibly damaging	0.93
R9512:Eif2ak4	UTSW	2	118462715	missense	probably damaging	1.00
R9569:Eif2ak4	UTSW	2	118420835	missense	probably benign	0.00
R9658:Eif2ak4	UTSW	2	118439030	missense	probably damaging	1.00
R9748:Eif2ak4	UTSW	2	118417249	missense	probably benign	0.01
R9757:Eif2ak4	UTSW	2	118438917	missense	probably benign	0.02
R9766:Eif2ak4	UTSW	2	118430832	nonsense	probably null
X0061:Eif2ak4	UTSW	2	118468176	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGGAATTCATTTTCCCATTAGC -3'
(R):5'- GGGCCCAGAATTACAGCTTC -3'

Sequencing Primer
(F):5'- ATTAGCACCTTCAACTCCATCC -3'
(R):5'- TCCTGCTAGGATGAGGGTCCTC -3'

Posted On

2019-10-17