Incidental Mutation 'R0617:Spata31d1a'
ID 58470
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Name spermatogenesis associated 31 subfamily D, member 1A
Synonyms 1700013B16Rik, Fam75d3, Fam75d1a
MMRRC Submission 038806-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R0617 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 59847897-59854401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59850073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 685 (I685N)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
AlphaFold E9QA35
Predicted Effect possibly damaging
Transcript: ENSMUST00000066510
AA Change: I685N

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: I685N

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect possibly damaging
Transcript: ENSMUST00000224982
AA Change: I685N

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555F03Rik A T 8: 49,953,527 (GRCm39) noncoding transcript Het
A630073D07Rik T C 6: 132,603,700 (GRCm39) probably benign Het
Abca16 G A 7: 120,032,834 (GRCm39) probably benign Het
Abca5 A T 11: 110,170,515 (GRCm39) D1265E probably damaging Het
Abcf1 C T 17: 36,272,079 (GRCm39) V312I probably benign Het
Abhd12 T A 2: 150,688,285 (GRCm39) probably null Het
Adam23 A G 1: 63,582,306 (GRCm39) H318R probably benign Het
Adcy2 T A 13: 68,826,725 (GRCm39) K660* probably null Het
Adgrf3 T C 5: 30,400,078 (GRCm39) T972A probably benign Het
Adipoq T A 16: 22,974,160 (GRCm39) D62E probably damaging Het
Alk G T 17: 72,910,578 (GRCm39) P43T probably damaging Het
Arap2 AT ATT 5: 62,807,250 (GRCm39) probably benign Het
Arhgef28 G T 13: 98,106,863 (GRCm39) T687K probably benign Het
Arrb1 T C 7: 99,243,884 (GRCm39) L278P probably damaging Het
Atad2b C A 12: 4,987,401 (GRCm39) D76E probably benign Het
Atm A T 9: 53,370,241 (GRCm39) Y2290* probably null Het
Atrn T A 2: 130,837,005 (GRCm39) probably null Het
Bpifb1 A G 2: 154,054,867 (GRCm39) D253G possibly damaging Het
Bpifb9b C T 2: 154,161,545 (GRCm39) T559M probably benign Het
Bsn T C 9: 107,984,439 (GRCm39) E3205G unknown Het
Cacna1c T C 6: 118,579,174 (GRCm39) Y1599C probably damaging Het
Ccdc40 A G 11: 119,133,630 (GRCm39) D590G probably damaging Het
Ccdc68 A G 18: 70,079,623 (GRCm39) probably null Het
Ccdc97 G A 7: 25,413,845 (GRCm39) R279C probably damaging Het
Ccm2l A G 2: 152,912,820 (GRCm39) T120A probably damaging Het
Cfap54 T C 10: 92,665,512 (GRCm39) probably benign Het
Cfh A G 1: 140,028,621 (GRCm39) S1043P probably benign Het
Chil3 T C 3: 106,063,072 (GRCm39) K173E probably benign Het
Cib2 T C 9: 54,461,780 (GRCm39) D26G possibly damaging Het
Col24a1 T C 3: 145,019,881 (GRCm39) V84A probably damaging Het
Csn3 T C 5: 88,077,730 (GRCm39) Y79H probably benign Het
Ddx47 T A 6: 134,994,085 (GRCm39) V149E probably damaging Het
Dennd5b A T 6: 148,934,760 (GRCm39) probably benign Het
Desi1 T C 15: 81,882,399 (GRCm39) N109D probably damaging Het
Fam13c T C 10: 70,372,182 (GRCm39) probably benign Het
Fam234a A T 17: 26,435,591 (GRCm39) D264E probably benign Het
Fanca A G 8: 124,014,809 (GRCm39) F831S probably damaging Het
Fancm C T 12: 65,144,091 (GRCm39) R518* probably null Het
Fat2 A G 11: 55,202,669 (GRCm39) V135A possibly damaging Het
Fbxl17 A C 17: 63,691,987 (GRCm39) F42V probably damaging Het
Fgd3 A T 13: 49,418,173 (GRCm39) V631E possibly damaging Het
Fhod3 G A 18: 25,245,736 (GRCm39) probably benign Het
Focad T C 4: 88,039,525 (GRCm39) probably benign Het
Foxn4 C A 5: 114,399,129 (GRCm39) probably benign Het
Gm2381 A T 7: 42,469,402 (GRCm39) C241S probably damaging Het
Gm6483 T G 8: 19,743,725 (GRCm39) F117V probably damaging Het
Hectd4 T C 5: 121,481,295 (GRCm39) probably benign Het
Hecw1 T A 13: 14,455,027 (GRCm39) Q676L probably benign Het
Hipk2 G A 6: 38,724,420 (GRCm39) R437C possibly damaging Het
Ifnar1 T C 16: 91,298,570 (GRCm39) Y396H probably damaging Het
Ints5 A T 19: 8,873,383 (GRCm39) K447N probably damaging Het
Iqsec1 T C 6: 90,666,952 (GRCm39) Y495C probably damaging Het
Itga5 C T 15: 103,264,742 (GRCm39) probably null Het
Kcnk4 T A 19: 6,905,528 (GRCm39) probably benign Het
Kmo A G 1: 175,474,756 (GRCm39) T174A possibly damaging Het
Krt36 T C 11: 99,993,101 (GRCm39) D458G probably damaging Het
Krtap16-1 G T 11: 99,877,321 (GRCm39) P28T probably damaging Het
Lama3 T C 18: 12,552,315 (GRCm39) probably null Het
Lrrc9 T C 12: 72,529,788 (GRCm39) S920P probably damaging Het
Lrrk2 A T 15: 91,636,481 (GRCm39) Y1485F probably benign Het
Mical1 C T 10: 41,357,311 (GRCm39) A372V probably damaging Het
Ms4a20 C A 19: 11,089,764 (GRCm39) L40F probably damaging Het
Mtr C T 13: 12,236,318 (GRCm39) R636Q probably benign Het
Muc4 A T 16: 32,570,925 (GRCm39) T662S possibly damaging Het
Myo10 G A 15: 25,738,091 (GRCm39) V546M probably damaging Het
Nbeal1 G A 1: 60,320,991 (GRCm39) W2034* probably null Het
Nhlrc3 T C 3: 53,366,044 (GRCm39) T150A probably damaging Het
Nicol1 T C 5: 34,140,896 (GRCm39) probably benign Het
Nkx2-1 T C 12: 56,581,640 (GRCm39) H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 (GRCm38) noncoding transcript Het
Nod2 A G 8: 89,379,859 (GRCm39) N120S probably benign Het
Nol8 T C 13: 49,807,921 (GRCm39) F46L possibly damaging Het
Ntrk1 T C 3: 87,691,240 (GRCm39) D308G possibly damaging Het
Oog3 A T 4: 143,886,784 (GRCm39) V112D probably benign Het
Or10ag58 A G 2: 87,265,005 (GRCm39) D58G probably damaging Het
Or4a66 A G 2: 88,531,040 (GRCm39) V211A probably damaging Het
Or51i1 A T 7: 103,671,196 (GRCm39) S110T probably damaging Het
Or5af2 T C 11: 58,707,975 (GRCm39) V47A probably damaging Het
Or5b106 T C 19: 13,123,727 (GRCm39) M99V probably benign Het
Or5b120 C A 19: 13,479,900 (GRCm39) N64K probably damaging Het
Or5m9b A G 2: 85,905,485 (GRCm39) M134V probably benign Het
Or9s18 A T 13: 65,300,692 (GRCm39) Y218F possibly damaging Het
Pakap T C 4: 57,829,434 (GRCm39) probably benign Het
Pcdhb8 C T 18: 37,490,100 (GRCm39) R593C probably benign Het
Pgm3 A G 9: 86,438,243 (GRCm39) probably null Het
Pirt T A 11: 66,816,998 (GRCm39) V103E probably damaging Het
Plxnc1 T A 10: 94,635,230 (GRCm39) D1332V probably damaging Het
Ppfia4 A T 1: 134,256,518 (GRCm39) V122E probably damaging Het
Pramel14 A G 4: 143,720,088 (GRCm39) probably benign Het
Prmt2 C T 10: 76,044,517 (GRCm39) probably benign Het
Prrc2a G T 17: 35,372,536 (GRCm39) P1702T probably damaging Het
Prss39 A T 1: 34,539,279 (GRCm39) H173L probably damaging Het
Rabl6 A G 2: 25,476,878 (GRCm39) probably null Het
Rb1cc1 T A 1: 6,319,014 (GRCm39) I794K possibly damaging Het
Reln T C 5: 22,125,535 (GRCm39) D2716G probably damaging Het
Sbf2 ACC AC 7: 109,929,890 (GRCm39) probably null Het
Sema6d T A 2: 124,502,665 (GRCm39) F583L possibly damaging Het
Setx T A 2: 29,036,819 (GRCm39) H1101Q possibly damaging Het
Sis A G 3: 72,872,938 (GRCm39) C67R probably damaging Het
Skint1 T A 4: 111,886,596 (GRCm39) probably benign Het
Smg6 C A 11: 75,053,757 (GRCm39) T1413K probably benign Het
Spef2 T A 15: 9,592,844 (GRCm39) N1499I probably damaging Het
Stk11ip T A 1: 75,508,932 (GRCm39) probably null Het
Stxbp1 A C 2: 32,692,795 (GRCm39) I407S probably damaging Het
Svil T C 18: 5,117,002 (GRCm39) S2059P probably damaging Het
Syne1 C T 10: 5,300,933 (GRCm39) V932M probably damaging Het
Tacc1 A C 8: 25,668,020 (GRCm39) probably benign Het
Tbc1d13 C A 2: 30,025,576 (GRCm39) probably benign Het
Tbc1d15 A C 10: 115,075,204 (GRCm39) D59E probably damaging Het
Tcaf2 A G 6: 42,619,445 (GRCm39) F194S probably damaging Het
Terf2ip T A 8: 112,738,127 (GRCm39) M5K probably benign Het
Tgfbr2 A T 9: 115,987,388 (GRCm39) D40E probably benign Het
Tm4sf5 T A 11: 70,401,495 (GRCm39) S165T probably damaging Het
Tmprss3 A T 17: 31,412,886 (GRCm39) C129S probably damaging Het
Tmx2 T C 2: 84,502,740 (GRCm39) D256G probably benign Het
Tnr A G 1: 159,695,673 (GRCm39) D532G probably damaging Het
Tnrc18 T A 5: 142,762,494 (GRCm39) H465L unknown Het
Togaram2 A T 17: 72,007,504 (GRCm39) Q350L possibly damaging Het
Topaz1 G A 9: 122,578,971 (GRCm39) C627Y possibly damaging Het
Tpx2 A T 2: 152,715,058 (GRCm39) Q93L probably benign Het
Trim54 T C 5: 31,293,526 (GRCm39) probably null Het
Troap T A 15: 98,980,541 (GRCm39) C574S probably damaging Het
Tut7 A T 13: 59,964,669 (GRCm39) probably null Het
Ubr4 T C 4: 139,206,373 (GRCm39) probably null Het
Vmn2r51 A G 7: 9,834,396 (GRCm39) V214A possibly damaging Het
Vmn2r66 A T 7: 84,644,484 (GRCm39) M642K probably benign Het
Vwa5a T A 9: 38,635,191 (GRCm39) I232N probably damaging Het
Zfp820 A T 17: 22,038,685 (GRCm39) S214R probably damaging Het
Zfp955b A T 17: 33,524,437 (GRCm39) S43R probably damaging Het
Zgrf1 C T 3: 127,381,687 (GRCm39) T1162M probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59,849,999 (GRCm39) missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59,849,552 (GRCm39) missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59,849,373 (GRCm39) missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59,851,549 (GRCm39) missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59,851,508 (GRCm39) missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59,848,840 (GRCm39) missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59,849,010 (GRCm39) missense probably benign
R0302:Spata31d1a UTSW 13 59,850,964 (GRCm39) missense probably benign
R0387:Spata31d1a UTSW 13 59,851,315 (GRCm39) missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59,849,573 (GRCm39) missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59,850,245 (GRCm39) missense probably benign 0.03
R0691:Spata31d1a UTSW 13 59,848,199 (GRCm39) missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59,850,077 (GRCm39) missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59,850,182 (GRCm39) missense probably benign
R1397:Spata31d1a UTSW 13 59,852,853 (GRCm39) splice site probably benign
R1543:Spata31d1a UTSW 13 59,850,056 (GRCm39) missense probably benign
R1619:Spata31d1a UTSW 13 59,850,247 (GRCm39) nonsense probably null
R1799:Spata31d1a UTSW 13 59,851,216 (GRCm39) missense probably benign
R1820:Spata31d1a UTSW 13 59,849,069 (GRCm39) missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59,849,821 (GRCm39) missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59,850,509 (GRCm39) missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59,850,370 (GRCm39) missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59,853,885 (GRCm39) missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59,848,857 (GRCm39) missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59,851,529 (GRCm39) missense probably benign
R2225:Spata31d1a UTSW 13 59,851,529 (GRCm39) missense probably benign
R2226:Spata31d1a UTSW 13 59,851,529 (GRCm39) missense probably benign
R2358:Spata31d1a UTSW 13 59,851,702 (GRCm39) missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59,849,807 (GRCm39) missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59,850,907 (GRCm39) missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59,849,180 (GRCm39) missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59,849,971 (GRCm39) missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59,852,861 (GRCm39) missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59,849,459 (GRCm39) missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59,848,969 (GRCm39) missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59,850,337 (GRCm39) missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59,849,542 (GRCm39) missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59,849,716 (GRCm39) missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59,850,965 (GRCm39) missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59,850,965 (GRCm39) missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59,850,965 (GRCm39) missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59,848,966 (GRCm39) splice site probably null
R5094:Spata31d1a UTSW 13 59,852,858 (GRCm39) critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59,848,217 (GRCm39) missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59,850,432 (GRCm39) missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59,849,380 (GRCm39) missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59,850,808 (GRCm39) missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59,848,378 (GRCm39) missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59,854,134 (GRCm39) start gained probably benign
R6250:Spata31d1a UTSW 13 59,849,615 (GRCm39) missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59,850,920 (GRCm39) missense probably benign
R6806:Spata31d1a UTSW 13 59,851,032 (GRCm39) missense probably benign
R6848:Spata31d1a UTSW 13 59,849,777 (GRCm39) missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59,851,725 (GRCm39) missense unknown
R6985:Spata31d1a UTSW 13 59,850,907 (GRCm39) missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59,851,448 (GRCm39) missense probably benign
R7037:Spata31d1a UTSW 13 59,848,138 (GRCm39) missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59,850,301 (GRCm39) missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59,849,913 (GRCm39) missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59,851,015 (GRCm39) missense probably benign
R7556:Spata31d1a UTSW 13 59,849,798 (GRCm39) missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59,851,953 (GRCm39) critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59,848,139 (GRCm39) missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59,848,924 (GRCm39) missense probably benign 0.06
R8379:Spata31d1a UTSW 13 59,850,668 (GRCm39) missense probably benign 0.00
R8497:Spata31d1a UTSW 13 59,848,988 (GRCm39) missense possibly damaging 0.91
R8837:Spata31d1a UTSW 13 59,850,596 (GRCm39) missense possibly damaging 0.92
R9108:Spata31d1a UTSW 13 59,850,982 (GRCm39) missense probably benign 0.00
Z1177:Spata31d1a UTSW 13 59,850,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCGAGAATGCCTTGAGCTGTCC -3'
(R):5'- GAAAGAGACTCATCCAGCGACACTG -3'

Sequencing Primer
(F):5'- TTGAGCTGTCCACAGCAC -3'
(R):5'- AGCGACACTGGGGCTTG -3'
Posted On 2013-07-11