Incidental Mutation 'R7555:Ankrd11'
ID584704
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122887406 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 2542 (A2542S)
Ref Sequence ENSEMBL: ENSMUSP00000095938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect probably damaging
Transcript: ENSMUST00000098333
AA Change: A2542S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: A2542S

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098334
AA Change: A2521S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: A2521S

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
Navy UTSW 8 122908734 nonsense probably null
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 unclassified probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 unclassified probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6145:Ankrd11 UTSW 8 122892661 missense probably damaging 1.00
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
R7477:Ankrd11 UTSW 8 122894385 missense possibly damaging 0.91
R7534:Ankrd11 UTSW 8 122894410 missense probably damaging 1.00
R7627:Ankrd11 UTSW 8 122890951 missense possibly damaging 0.63
R7658:Ankrd11 UTSW 8 122893664 missense probably benign
R7721:Ankrd11 UTSW 8 122894759 missense probably damaging 1.00
R7731:Ankrd11 UTSW 8 122895433 missense probably benign 0.12
R7792:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R8022:Ankrd11 UTSW 8 122887593 missense probably damaging 1.00
RF019:Ankrd11 UTSW 8 122896634 missense probably damaging 1.00
Z1176:Ankrd11 UTSW 8 122895803 missense possibly damaging 0.68
Z1177:Ankrd11 UTSW 8 122900142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTGTCCGTGACATTACTG -3'
(R):5'- CCCTGAAGGAGCTGTTCAAG -3'

Sequencing Primer
(F):5'- ACATTACTGTGCCTTCTGAGG -3'
(R):5'- CTGTTCAAGCAACAAGAGGCTGTG -3'
Posted On2019-10-17