Incidental Mutation 'R7555:Dis3l'
ID 584706
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene Name DIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission 045623-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R7555 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 64214038-64248570 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 64219219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 570 (Y570*)
Ref Sequence ENSEMBL: ENSMUSP00000129772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844]
AlphaFold Q8C0S1
Predicted Effect probably null
Transcript: ENSMUST00000068367
AA Change: Y487*
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: Y487*

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113890
AA Change: Y487*
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: Y487*

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120760
AA Change: Y487*
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: Y487*

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168844
AA Change: Y570*
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: Y570*

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,248,924 (GRCm39) I97N probably damaging Het
Acvrl1 A G 15: 101,041,354 (GRCm39) H502R probably benign Het
Adgrf4 T C 17: 42,983,494 (GRCm39) S63G probably benign Het
Agbl2 C A 2: 90,621,899 (GRCm39) L129I probably damaging Het
Ankrd11 C A 8: 123,614,145 (GRCm39) A2542S probably damaging Het
Armc9 A G 1: 86,203,400 (GRCm39) K818R probably damaging Het
Arsj T A 3: 126,231,885 (GRCm39) C210* probably null Het
Aspscr1 C T 11: 120,563,926 (GRCm39) A11V unknown Het
Bicc1 G T 10: 70,792,121 (GRCm39) Q296K possibly damaging Het
Borcs5 A C 6: 134,662,942 (GRCm39) Q73P probably benign Het
Capn15 G T 17: 26,182,406 (GRCm39) D567E probably damaging Het
Catsperg1 A C 7: 28,889,239 (GRCm39) I866S probably damaging Het
Ccdc27 G T 4: 154,126,274 (GRCm39) H72N unknown Het
Ccser2 A T 14: 36,601,457 (GRCm39) M309K possibly damaging Het
Cd1d2 A G 3: 86,894,408 (GRCm39) S59G probably benign Het
Chml G A 1: 175,515,456 (GRCm39) P155L probably benign Het
Csmd2 C T 4: 128,346,251 (GRCm39) P1504S Het
Dcbld2 A G 16: 58,269,081 (GRCm39) probably null Het
Ddx21 C T 10: 62,434,022 (GRCm39) E246K probably benign Het
Dhx29 C T 13: 113,064,176 (GRCm39) probably benign Het
Dnah14 T A 1: 181,597,619 (GRCm39) Y3623N probably benign Het
Dock8 A G 19: 25,152,764 (GRCm39) D1610G probably damaging Het
Dync1h1 T C 12: 110,597,059 (GRCm39) S1669P probably benign Het
Eif1ad12 A C 12: 87,541,505 (GRCm39) K5N unknown Het
Eif2ak4 T A 2: 118,247,764 (GRCm39) I267N possibly damaging Het
Ern2 A T 7: 121,769,464 (GRCm39) V854E probably damaging Het
Fuca2 G A 10: 13,383,174 (GRCm39) probably null Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gm1110 T A 9: 26,804,924 (GRCm39) T380S probably benign Het
Golga2 G A 2: 32,178,178 (GRCm39) R29H probably benign Het
Grik5 T C 7: 24,760,022 (GRCm39) E259G probably benign Het
Grm3 T C 5: 9,620,000 (GRCm39) T415A probably benign Het
Gtf3c1 A G 7: 125,244,842 (GRCm39) Y1731H probably damaging Het
Hectd2 T C 19: 36,589,803 (GRCm39) C643R probably damaging Het
Hgfac T C 5: 35,199,972 (GRCm39) S118P probably damaging Het
Hmcn1 A G 1: 150,480,625 (GRCm39) V4517A probably benign Het
Hnrnpc A T 14: 52,312,610 (GRCm39) L290* probably null Het
Homer3 A G 8: 70,742,063 (GRCm39) E108G probably damaging Het
Hsd17b3 G T 13: 64,219,816 (GRCm39) S141R probably benign Het
Hspa12b C T 2: 130,980,396 (GRCm39) T105I probably damaging Het
Ifi202b T C 1: 173,799,787 (GRCm39) I231M probably damaging Het
Inhba T A 13: 16,192,222 (GRCm39) N114K probably benign Het
Kmt2b C A 7: 30,268,835 (GRCm39) M2631I possibly damaging Het
Loxhd1 C T 18: 77,483,061 (GRCm39) T1214I probably damaging Het
Lrp1 G T 10: 127,382,731 (GRCm39) N3683K probably damaging Het
Lrrc8e A G 8: 4,284,363 (GRCm39) K196R probably benign Het
Lrrn3 A T 12: 41,502,910 (GRCm39) M469K probably benign Het
Mafb T C 2: 160,207,749 (GRCm39) E283G probably damaging Het
Mapt C A 11: 104,189,528 (GRCm39) P182Q probably benign Het
Mmp14 G T 14: 54,675,199 (GRCm39) R277L possibly damaging Het
Mucl2 T A 15: 103,927,711 (GRCm39) N82I probably benign Het
Nsun6 T A 2: 15,001,150 (GRCm39) T469S possibly damaging Het
Or13p4 T C 4: 118,546,839 (GRCm39) D270G possibly damaging Het
Or5p79 G C 7: 108,221,933 (GRCm39) A305P probably damaging Het
Or8k30 A C 2: 86,339,691 (GRCm39) D296A probably damaging Het
Osbpl5 A T 7: 143,248,670 (GRCm39) F631I possibly damaging Het
Otud3 G T 4: 138,629,196 (GRCm39) D190E possibly damaging Het
Pcdhb6 A T 18: 37,468,332 (GRCm39) I418F possibly damaging Het
Per1 G A 11: 68,997,339 (GRCm39) R838H probably damaging Het
Per2 G A 1: 91,362,857 (GRCm39) P395S probably damaging Het
Per3 G A 4: 151,102,515 (GRCm39) Q583* probably null Het
Pkhd1l1 A T 15: 44,414,157 (GRCm39) H2808L possibly damaging Het
Ppfia2 A G 10: 106,763,687 (GRCm39) T1227A probably benign Het
Pramel30 T C 4: 144,059,311 (GRCm39) F341L probably benign Het
Psg17 C T 7: 18,551,019 (GRCm39) D279N probably benign Het
Rnf167 A G 11: 70,541,623 (GRCm39) D235G probably benign Het
Rxfp3 A G 15: 11,036,362 (GRCm39) S337P probably damaging Het
Sall1 T C 8: 89,759,786 (GRCm39) D106G possibly damaging Het
Sema4f A G 6: 82,891,037 (GRCm39) V590A probably benign Het
Setd1b A G 5: 123,295,820 (GRCm39) D1102G unknown Het
Six2 C A 17: 85,995,135 (GRCm39) K82N probably damaging Het
Snx29 T C 16: 11,218,806 (GRCm39) M214T probably benign Het
Son T C 16: 91,455,810 (GRCm39) L1519P probably damaging Het
Speer1h A T 5: 11,647,579 (GRCm39) N106Y probably damaging Het
Spin1 C T 13: 51,303,085 (GRCm39) S226L probably benign Het
Stxbp5l T C 16: 37,143,965 (GRCm39) D131G probably damaging Het
Svep1 T C 4: 58,069,422 (GRCm39) Y2788C probably damaging Het
Tbl3 C A 17: 24,920,950 (GRCm39) probably null Het
Themis A T 10: 28,657,698 (GRCm39) I242L possibly damaging Het
Tmem203 G A 2: 25,145,742 (GRCm39) V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 (GRCm39) C171R probably benign Het
Tsg101 A G 7: 46,563,159 (GRCm39) Y32H probably damaging Het
Tyw1 A G 5: 130,303,547 (GRCm39) D305G probably damaging Het
Vmn1r40 A T 6: 89,692,026 (GRCm39) Y281F probably damaging Het
Vmn2r105 T A 17: 20,447,937 (GRCm39) T296S probably damaging Het
Vmn2r13 T C 5: 109,319,557 (GRCm39) probably null Het
Zfp933 A G 4: 147,910,589 (GRCm39) F336L probably damaging Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64,226,536 (GRCm39) critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64,217,519 (GRCm39) missense probably benign 0.00
IGL01838:Dis3l APN 9 64,215,581 (GRCm39) missense probably benign 0.41
IGL02104:Dis3l APN 9 64,217,611 (GRCm39) missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64,222,055 (GRCm39) missense probably benign 0.00
IGL02481:Dis3l APN 9 64,226,362 (GRCm39) splice site probably null
IGL02483:Dis3l APN 9 64,226,362 (GRCm39) splice site probably null
IGL02965:Dis3l APN 9 64,217,766 (GRCm39) missense probably damaging 0.99
IGL03139:Dis3l APN 9 64,219,232 (GRCm39) missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64,217,722 (GRCm39) critical splice donor site probably null
R0066:Dis3l UTSW 9 64,226,447 (GRCm39) missense probably benign 0.27
R0066:Dis3l UTSW 9 64,226,447 (GRCm39) missense probably benign 0.27
R0724:Dis3l UTSW 9 64,214,408 (GRCm39) missense possibly damaging 0.92
R0801:Dis3l UTSW 9 64,226,436 (GRCm39) missense probably benign
R0925:Dis3l UTSW 9 64,248,412 (GRCm39) start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64,233,069 (GRCm39) missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64,214,771 (GRCm39) missense probably benign 0.07
R1794:Dis3l UTSW 9 64,225,058 (GRCm39) missense possibly damaging 0.67
R1929:Dis3l UTSW 9 64,238,165 (GRCm39) missense probably damaging 0.96
R2007:Dis3l UTSW 9 64,215,558 (GRCm39) splice site probably null
R2062:Dis3l UTSW 9 64,246,855 (GRCm39) missense probably benign 0.02
R2152:Dis3l UTSW 9 64,214,545 (GRCm39) missense probably benign 0.00
R2153:Dis3l UTSW 9 64,214,545 (GRCm39) missense probably benign 0.00
R2154:Dis3l UTSW 9 64,214,545 (GRCm39) missense probably benign 0.00
R2186:Dis3l UTSW 9 64,246,894 (GRCm39) nonsense probably null
R2271:Dis3l UTSW 9 64,238,165 (GRCm39) missense probably damaging 0.96
R2280:Dis3l UTSW 9 64,225,076 (GRCm39) missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64,214,779 (GRCm39) missense probably benign 0.20
R3156:Dis3l UTSW 9 64,219,032 (GRCm39) missense probably benign 0.25
R4664:Dis3l UTSW 9 64,238,080 (GRCm39) missense unknown
R4775:Dis3l UTSW 9 64,238,190 (GRCm39) missense probably benign 0.16
R4977:Dis3l UTSW 9 64,214,483 (GRCm39) missense probably benign 0.00
R4997:Dis3l UTSW 9 64,219,224 (GRCm39) missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64,226,498 (GRCm39) missense probably damaging 1.00
R5579:Dis3l UTSW 9 64,238,117 (GRCm39) missense probably benign 0.44
R5623:Dis3l UTSW 9 64,214,885 (GRCm39) missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64,229,857 (GRCm39) missense probably benign 0.00
R6442:Dis3l UTSW 9 64,214,837 (GRCm39) missense probably benign
R6505:Dis3l UTSW 9 64,214,795 (GRCm39) missense probably benign 0.15
R6731:Dis3l UTSW 9 64,217,720 (GRCm39) splice site probably null
R7008:Dis3l UTSW 9 64,217,735 (GRCm39) missense possibly damaging 0.96
R7405:Dis3l UTSW 9 64,221,986 (GRCm39) missense probably damaging 1.00
R7798:Dis3l UTSW 9 64,248,299 (GRCm39) missense probably benign
R7890:Dis3l UTSW 9 64,229,753 (GRCm39) missense probably benign 0.00
R8329:Dis3l UTSW 9 64,219,112 (GRCm39) missense possibly damaging 0.50
R8715:Dis3l UTSW 9 64,214,342 (GRCm39) missense probably benign
R8942:Dis3l UTSW 9 64,214,875 (GRCm39) missense probably benign 0.22
R8973:Dis3l UTSW 9 64,246,824 (GRCm39) missense probably damaging 0.96
R9189:Dis3l UTSW 9 64,217,731 (GRCm39) missense probably benign 0.21
R9240:Dis3l UTSW 9 64,217,447 (GRCm39) critical splice donor site probably null
R9354:Dis3l UTSW 9 64,221,922 (GRCm39) missense probably benign 0.01
R9394:Dis3l UTSW 9 64,225,017 (GRCm39) missense probably benign 0.24
R9569:Dis3l UTSW 9 64,236,829 (GRCm39) missense unknown
X0020:Dis3l UTSW 9 64,233,016 (GRCm39) missense probably damaging 1.00
X0065:Dis3l UTSW 9 64,214,336 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCGAGCTATGTCTGTCAAC -3'
(R):5'- CAAGTTCTGCTTGCCTCTAAATTAG -3'

Sequencing Primer
(F):5'- AGCTATGTCTGTCAACTTTCCAATTG -3'
(R):5'- GTGTTCAGCCATACATGCAG -3'
Posted On 2019-10-17