Incidental Mutation 'R7555:Bicc1'
ID584710
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70956291 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 296 (Q296K)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably benign
Transcript: ENSMUST00000014473
AA Change: Q296K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: Q296K

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131445
AA Change: Q214K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: Q214K

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143791
AA Change: Q296K

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: Q296K

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
R8129:Bicc1 UTSW 10 71079203 missense probably benign 0.01
R8270:Bicc1 UTSW 10 70932108 missense probably damaging 0.99
R8525:Bicc1 UTSW 10 70943535 missense possibly damaging 0.67
R8762:Bicc1 UTSW 10 70943386 missense probably benign 0.03
R8849:Bicc1 UTSW 10 70946864 missense probably benign 0.23
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAGATACTGCCTTGC -3'
(R):5'- AGAACATGCTGCTGATGTTTC -3'

Sequencing Primer
(F):5'- CTTGCTAGGCAGACAGACTCAATG -3'
(R):5'- AGAACATGCTGCTGATGTTTCTAGAG -3'
Posted On2019-10-17