Incidental Mutation 'R7555:Per1'
ID584713
Institutional Source Beutler Lab
Gene Symbol Per1
Ensembl Gene ENSMUSG00000020893
Gene Nameperiod circadian clock 1
SynonymsmPer1, m-rigui
MMRRC Submission
Accession Numbers

Genbank: NM_011065; MGI:1098283

Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69095217-69109960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69106513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 838 (R838H)
Ref Sequence ENSEMBL: ENSMUSP00000021271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021271] [ENSMUST00000101004] [ENSMUST00000102605] [ENSMUST00000142392] [ENSMUST00000166748]
PDB Structure Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021271
AA Change: R838H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021271
Gene: ENSMUSG00000020893
AA Change: R838H

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1222 1.5e-78 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101004
SMART Domains Protein: ENSMUSP00000098566
Gene: ENSMUSG00000020893

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102605
AA Change: R818H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099665
Gene: ENSMUSG00000020893
AA Change: R818H

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Blast:PAS 203 255 1e-23 BLAST
PAS 328 394 1.12e-4 SMART
PAC 402 445 1.6e0 SMART
low complexity region 453 461 N/A INTRINSIC
low complexity region 493 523 N/A INTRINSIC
low complexity region 551 558 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 727 752 N/A INTRINSIC
low complexity region 774 788 N/A INTRINSIC
low complexity region 797 824 N/A INTRINSIC
low complexity region 832 857 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
low complexity region 925 952 N/A INTRINSIC
low complexity region 976 993 N/A INTRINSIC
Pfam:Period_C 1011 1210 7.5e-75 PFAM
low complexity region 1250 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142392
SMART Domains Protein: ENSMUSP00000121713
Gene: ENSMUSG00000020893

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166748
AA Change: R838H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132635
Gene: ENSMUSG00000020893
AA Change: R838H

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1230 5.2e-75 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display a persistent circadian rhythm, but they have a shorter period and their ability to maintain the precision and the stability of the period is impaired. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(3) Gene trapped(5)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Per1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Per1 APN 11 69104199 missense probably damaging 1.00
IGL01907:Per1 APN 11 69105599 missense probably benign 0.00
IGL02078:Per1 APN 11 69104299 missense probably damaging 1.00
IGL02296:Per1 APN 11 69102175 missense probably damaging 1.00
IGL02677:Per1 APN 11 69106660 missense probably benign 0.07
0152:Per1 UTSW 11 69104022 splice site probably benign
IGL03048:Per1 UTSW 11 69104726 missense probably damaging 0.99
P0043:Per1 UTSW 11 69102043 splice site probably benign
R0089:Per1 UTSW 11 69104043 missense probably benign 0.27
R0116:Per1 UTSW 11 69101880 splice site probably benign
R0395:Per1 UTSW 11 69102277 missense probably damaging 1.00
R0531:Per1 UTSW 11 69104190 missense probably damaging 1.00
R0681:Per1 UTSW 11 69101201 missense probably damaging 1.00
R0788:Per1 UTSW 11 69101359 splice site probably benign
R1233:Per1 UTSW 11 69102211 missense probably damaging 1.00
R1554:Per1 UTSW 11 69103627 missense probably damaging 1.00
R3793:Per1 UTSW 11 69109301 missense probably benign 0.30
R4706:Per1 UTSW 11 69100618 start gained probably benign
R4716:Per1 UTSW 11 69101231 missense probably damaging 1.00
R4965:Per1 UTSW 11 69104401 missense probably benign 0.06
R5111:Per1 UTSW 11 69100786 missense probably damaging 1.00
R5270:Per1 UTSW 11 69103598 missense probably benign
R5583:Per1 UTSW 11 69103445 missense probably damaging 1.00
R5588:Per1 UTSW 11 69107627 missense probably damaging 1.00
R6184:Per1 UTSW 11 69102904 missense probably damaging 1.00
R6430:Per1 UTSW 11 69104296 missense probably damaging 1.00
R6819:Per1 UTSW 11 69101458 missense probably damaging 1.00
R6911:Per1 UTSW 11 69103257 missense probably damaging 1.00
R7158:Per1 UTSW 11 69104104 unclassified probably benign
R7340:Per1 UTSW 11 69103182 missense probably damaging 1.00
R7438:Per1 UTSW 11 69104735 missense possibly damaging 0.79
R7513:Per1 UTSW 11 69105571 missense probably benign 0.00
R7921:Per1 UTSW 11 69100779 missense probably damaging 1.00
R8059:Per1 UTSW 11 69106483 missense probably damaging 1.00
R8345:Per1 UTSW 11 69107556 missense possibly damaging 0.63
R8408:Per1 UTSW 11 69109127 missense possibly damaging 0.86
X0023:Per1 UTSW 11 69103124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACATGCAGGGTGAGCAG -3'
(R):5'- TAGTTAGGGAGCACCAAGGC -3'

Sequencing Primer
(F):5'- CATGCAGGGTGAGCAGCTTTC -3'
(R):5'- CCATTGGGGTCACTAAGGG -3'
Posted On2019-10-17