Incidental Mutation 'R7555:Mapt'
ID584715
Institutional Source Beutler Lab
Gene Symbol Mapt
Ensembl Gene ENSMUSG00000018411
Gene Namemicrotubule-associated protein tau
SynonymsMtapt, Tau
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104231390-104332090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104298702 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 182 (P182Q)
Ref Sequence ENSEMBL: ENSMUSP00000102602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100347] [ENSMUST00000106988] [ENSMUST00000106989] [ENSMUST00000106992] [ENSMUST00000106993] [ENSMUST00000132245] [ENSMUST00000132977] [ENSMUST00000145227]
Predicted Effect probably benign
Transcript: ENSMUST00000100347
SMART Domains Protein: ENSMUSP00000097919
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 127 139 N/A INTRINSIC
low complexity region 163 212 N/A INTRINSIC
Pfam:Tubulin-binding 232 263 1.4e-18 PFAM
Pfam:Tubulin-binding 264 294 3.3e-21 PFAM
Pfam:Tubulin-binding 295 325 1.6e-19 PFAM
Pfam:Tubulin-binding 326 357 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106988
AA Change: P166Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102601
Gene: ENSMUSG00000018411
AA Change: P166Q

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 466 515 N/A INTRINSIC
Pfam:Tubulin-binding 535 566 3.5e-19 PFAM
Pfam:Tubulin-binding 567 597 8.6e-22 PFAM
Pfam:Tubulin-binding 598 628 4e-20 PFAM
Pfam:Tubulin-binding 629 660 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106989
AA Change: P182Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102602
Gene: ENSMUSG00000018411
AA Change: P182Q

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 482 531 N/A INTRINSIC
Pfam:Tubulin-binding 552 582 1.7e-13 PFAM
Pfam:Tubulin-binding 583 613 6.8e-20 PFAM
Pfam:Tubulin-binding 614 644 2.3e-17 PFAM
Pfam:Tubulin-binding 645 676 3.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106992
SMART Domains Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 105 154 N/A INTRINSIC
Pfam:Tubulin-binding 174 205 6.1e-19 PFAM
Pfam:Tubulin-binding 206 236 1.5e-21 PFAM
Pfam:Tubulin-binding 237 267 6.9e-20 PFAM
Pfam:Tubulin-binding 268 299 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106993
SMART Domains Protein: ENSMUSP00000102606
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 140 172 N/A INTRINSIC
Pfam:Tubulin-binding 192 223 4.6e-19 PFAM
Pfam:Tubulin-binding 224 254 1.1e-21 PFAM
Pfam:Tubulin-binding 255 285 5.3e-20 PFAM
Pfam:Tubulin-binding 286 317 3.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132245
Predicted Effect probably benign
Transcript: ENSMUST00000132977
SMART Domains Protein: ENSMUSP00000123260
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit altered performance in behavioral tests and show mircotubule changes in small-calibre axons. Embryonic hippocampal cultures from mutants exhibit delayed axonal and neuritic maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Mapt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Mapt APN 11 104322485 missense probably damaging 1.00
IGL00473:Mapt APN 11 104287183 missense probably damaging 1.00
IGL01599:Mapt APN 11 104294915 missense probably damaging 1.00
IGL01862:Mapt APN 11 104290002 intron probably benign
IGL02315:Mapt APN 11 104328078 missense probably damaging 0.99
IGL03369:Mapt APN 11 104282433 missense probably damaging 1.00
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R1913:Mapt UTSW 11 104328075 missense probably damaging 1.00
R1918:Mapt UTSW 11 104298499 missense probably benign 0.26
R3423:Mapt UTSW 11 104298722 nonsense probably null
R3425:Mapt UTSW 11 104298722 nonsense probably null
R3831:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R3833:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R4095:Mapt UTSW 11 104310536 critical splice donor site probably null
R4814:Mapt UTSW 11 104298960 missense probably benign 0.04
R4890:Mapt UTSW 11 104328149 missense probably damaging 1.00
R5613:Mapt UTSW 11 104302390 missense possibly damaging 0.82
R6415:Mapt UTSW 11 104298998 missense probably benign 0.01
R6956:Mapt UTSW 11 104318255 splice site probably null
R7395:Mapt UTSW 11 104328123 missense probably damaging 0.99
R7406:Mapt UTSW 11 104322524 missense possibly damaging 0.94
R7547:Mapt UTSW 11 104322312 splice site probably null
R7554:Mapt UTSW 11 104298702 missense probably benign 0.09
R7556:Mapt UTSW 11 104298702 missense probably benign 0.09
R8285:Mapt UTSW 11 104298802 missense probably benign 0.01
R8694:Mapt UTSW 11 104298614 missense probably benign
R8841:Mapt UTSW 11 104310377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCTTGTCGAACCAGGG -3'
(R):5'- TCTGCGGAGACTTTGGAGAAG -3'

Sequencing Primer
(F):5'- TTGTCGAACCAGGGCGTCG -3'
(R):5'- GGACGGAACCCTCAGTTG -3'
Posted On2019-10-17