Incidental Mutation 'R7555:Inhba'
ID 584720
Institutional Source Beutler Lab
Gene Symbol Inhba
Ensembl Gene ENSMUSG00000041324
Gene Name inhibin beta-A
Synonyms activin beta-A
MMRRC Submission 045623-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7555 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 16186436-16206206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16192222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 114 (N114K)
Ref Sequence ENSEMBL: ENSMUSP00000047894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042603] [ENSMUST00000164993]
AlphaFold Q04998
Predicted Effect probably benign
Transcript: ENSMUST00000042603
AA Change: N114K

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047894
Gene: ENSMUSG00000041324
AA Change: N114K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 37 294 9.5e-20 PFAM
TGFB 319 424 1.3e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164993
AA Change: N114K

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132085
Gene: ENSMUSG00000041324
AA Change: N114K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 45 293 3.8e-12 PFAM
TGFB 319 424 1.3e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Homozygous knockout mice for this gene lack whiskers and exhibit tooth and palate defects, leading to neonatal lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation lack vibrissae and lower incisors, have defects in their secondary palates, and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,248,924 (GRCm39) I97N probably damaging Het
Acvrl1 A G 15: 101,041,354 (GRCm39) H502R probably benign Het
Adgrf4 T C 17: 42,983,494 (GRCm39) S63G probably benign Het
Agbl2 C A 2: 90,621,899 (GRCm39) L129I probably damaging Het
Ankrd11 C A 8: 123,614,145 (GRCm39) A2542S probably damaging Het
Armc9 A G 1: 86,203,400 (GRCm39) K818R probably damaging Het
Arsj T A 3: 126,231,885 (GRCm39) C210* probably null Het
Aspscr1 C T 11: 120,563,926 (GRCm39) A11V unknown Het
Bicc1 G T 10: 70,792,121 (GRCm39) Q296K possibly damaging Het
Borcs5 A C 6: 134,662,942 (GRCm39) Q73P probably benign Het
Capn15 G T 17: 26,182,406 (GRCm39) D567E probably damaging Het
Catsperg1 A C 7: 28,889,239 (GRCm39) I866S probably damaging Het
Ccdc27 G T 4: 154,126,274 (GRCm39) H72N unknown Het
Ccser2 A T 14: 36,601,457 (GRCm39) M309K possibly damaging Het
Cd1d2 A G 3: 86,894,408 (GRCm39) S59G probably benign Het
Chml G A 1: 175,515,456 (GRCm39) P155L probably benign Het
Csmd2 C T 4: 128,346,251 (GRCm39) P1504S Het
Dcbld2 A G 16: 58,269,081 (GRCm39) probably null Het
Ddx21 C T 10: 62,434,022 (GRCm39) E246K probably benign Het
Dhx29 C T 13: 113,064,176 (GRCm39) probably benign Het
Dis3l A C 9: 64,219,219 (GRCm39) Y570* probably null Het
Dnah14 T A 1: 181,597,619 (GRCm39) Y3623N probably benign Het
Dock8 A G 19: 25,152,764 (GRCm39) D1610G probably damaging Het
Dync1h1 T C 12: 110,597,059 (GRCm39) S1669P probably benign Het
Eif1ad12 A C 12: 87,541,505 (GRCm39) K5N unknown Het
Eif2ak4 T A 2: 118,247,764 (GRCm39) I267N possibly damaging Het
Ern2 A T 7: 121,769,464 (GRCm39) V854E probably damaging Het
Fuca2 G A 10: 13,383,174 (GRCm39) probably null Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gm1110 T A 9: 26,804,924 (GRCm39) T380S probably benign Het
Golga2 G A 2: 32,178,178 (GRCm39) R29H probably benign Het
Grik5 T C 7: 24,760,022 (GRCm39) E259G probably benign Het
Grm3 T C 5: 9,620,000 (GRCm39) T415A probably benign Het
Gtf3c1 A G 7: 125,244,842 (GRCm39) Y1731H probably damaging Het
Hectd2 T C 19: 36,589,803 (GRCm39) C643R probably damaging Het
Hgfac T C 5: 35,199,972 (GRCm39) S118P probably damaging Het
Hmcn1 A G 1: 150,480,625 (GRCm39) V4517A probably benign Het
Hnrnpc A T 14: 52,312,610 (GRCm39) L290* probably null Het
Homer3 A G 8: 70,742,063 (GRCm39) E108G probably damaging Het
Hsd17b3 G T 13: 64,219,816 (GRCm39) S141R probably benign Het
Hspa12b C T 2: 130,980,396 (GRCm39) T105I probably damaging Het
Ifi202b T C 1: 173,799,787 (GRCm39) I231M probably damaging Het
Kmt2b C A 7: 30,268,835 (GRCm39) M2631I possibly damaging Het
Loxhd1 C T 18: 77,483,061 (GRCm39) T1214I probably damaging Het
Lrp1 G T 10: 127,382,731 (GRCm39) N3683K probably damaging Het
Lrrc8e A G 8: 4,284,363 (GRCm39) K196R probably benign Het
Lrrn3 A T 12: 41,502,910 (GRCm39) M469K probably benign Het
Mafb T C 2: 160,207,749 (GRCm39) E283G probably damaging Het
Mapt C A 11: 104,189,528 (GRCm39) P182Q probably benign Het
Mmp14 G T 14: 54,675,199 (GRCm39) R277L possibly damaging Het
Mucl2 T A 15: 103,927,711 (GRCm39) N82I probably benign Het
Nsun6 T A 2: 15,001,150 (GRCm39) T469S possibly damaging Het
Or13p4 T C 4: 118,546,839 (GRCm39) D270G possibly damaging Het
Or5p79 G C 7: 108,221,933 (GRCm39) A305P probably damaging Het
Or8k30 A C 2: 86,339,691 (GRCm39) D296A probably damaging Het
Osbpl5 A T 7: 143,248,670 (GRCm39) F631I possibly damaging Het
Otud3 G T 4: 138,629,196 (GRCm39) D190E possibly damaging Het
Pcdhb6 A T 18: 37,468,332 (GRCm39) I418F possibly damaging Het
Per1 G A 11: 68,997,339 (GRCm39) R838H probably damaging Het
Per2 G A 1: 91,362,857 (GRCm39) P395S probably damaging Het
Per3 G A 4: 151,102,515 (GRCm39) Q583* probably null Het
Pkhd1l1 A T 15: 44,414,157 (GRCm39) H2808L possibly damaging Het
Ppfia2 A G 10: 106,763,687 (GRCm39) T1227A probably benign Het
Pramel30 T C 4: 144,059,311 (GRCm39) F341L probably benign Het
Psg17 C T 7: 18,551,019 (GRCm39) D279N probably benign Het
Rnf167 A G 11: 70,541,623 (GRCm39) D235G probably benign Het
Rxfp3 A G 15: 11,036,362 (GRCm39) S337P probably damaging Het
Sall1 T C 8: 89,759,786 (GRCm39) D106G possibly damaging Het
Sema4f A G 6: 82,891,037 (GRCm39) V590A probably benign Het
Setd1b A G 5: 123,295,820 (GRCm39) D1102G unknown Het
Six2 C A 17: 85,995,135 (GRCm39) K82N probably damaging Het
Snx29 T C 16: 11,218,806 (GRCm39) M214T probably benign Het
Son T C 16: 91,455,810 (GRCm39) L1519P probably damaging Het
Speer1h A T 5: 11,647,579 (GRCm39) N106Y probably damaging Het
Spin1 C T 13: 51,303,085 (GRCm39) S226L probably benign Het
Stxbp5l T C 16: 37,143,965 (GRCm39) D131G probably damaging Het
Svep1 T C 4: 58,069,422 (GRCm39) Y2788C probably damaging Het
Tbl3 C A 17: 24,920,950 (GRCm39) probably null Het
Themis A T 10: 28,657,698 (GRCm39) I242L possibly damaging Het
Tmem203 G A 2: 25,145,742 (GRCm39) V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 (GRCm39) C171R probably benign Het
Tsg101 A G 7: 46,563,159 (GRCm39) Y32H probably damaging Het
Tyw1 A G 5: 130,303,547 (GRCm39) D305G probably damaging Het
Vmn1r40 A T 6: 89,692,026 (GRCm39) Y281F probably damaging Het
Vmn2r105 T A 17: 20,447,937 (GRCm39) T296S probably damaging Het
Vmn2r13 T C 5: 109,319,557 (GRCm39) probably null Het
Zfp933 A G 4: 147,910,589 (GRCm39) F336L probably damaging Het
Other mutations in Inhba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Inhba APN 13 16,201,557 (GRCm39) missense probably benign 0.00
IGL02666:Inhba APN 13 16,201,664 (GRCm39) missense possibly damaging 0.87
IGL03138:Inhba UTSW 13 16,192,099 (GRCm39) missense probably benign
R0020:Inhba UTSW 13 16,200,949 (GRCm39) missense possibly damaging 0.46
R0591:Inhba UTSW 13 16,201,405 (GRCm39) missense probably damaging 1.00
R1510:Inhba UTSW 13 16,201,607 (GRCm39) missense probably damaging 0.99
R1667:Inhba UTSW 13 16,201,209 (GRCm39) missense possibly damaging 0.90
R1966:Inhba UTSW 13 16,201,221 (GRCm39) missense probably damaging 1.00
R4710:Inhba UTSW 13 16,201,068 (GRCm39) missense probably benign
R4893:Inhba UTSW 13 16,201,134 (GRCm39) missense possibly damaging 0.61
R5472:Inhba UTSW 13 16,201,371 (GRCm39) missense probably damaging 0.99
R5905:Inhba UTSW 13 16,191,893 (GRCm39) missense probably benign 0.05
R7965:Inhba UTSW 13 16,201,572 (GRCm39) missense possibly damaging 0.75
R8031:Inhba UTSW 13 16,200,860 (GRCm39) missense possibly damaging 0.86
R8997:Inhba UTSW 13 16,201,107 (GRCm39) missense possibly damaging 0.94
R9004:Inhba UTSW 13 16,201,526 (GRCm39) missense probably benign 0.05
R9359:Inhba UTSW 13 16,191,966 (GRCm39) missense probably benign 0.01
R9403:Inhba UTSW 13 16,191,966 (GRCm39) missense probably benign 0.01
R9474:Inhba UTSW 13 16,192,263 (GRCm39) missense probably benign 0.03
R9505:Inhba UTSW 13 16,201,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTCAAGAAGCACATC -3'
(R):5'- GTGTAAGCTAGCCATTGCGG -3'

Sequencing Primer
(F):5'- GCACATCTTAAACATGCTGCACTTG -3'
(R):5'- TGGCAAAGAAGTCCTTTCCC -3'
Posted On 2019-10-17