Mutagenetix > Incidental Mutations

Incidental Mutation 'R7555:Dhx29'

584723

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7555 (G1)

Quality Score

82.0076

Status

Validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

C to T at 112927642 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022281] [ENSMUST00000038574] [ENSMUST00000224176]

Predicted Effect

probably benign
Transcript: ENSMUST00000022281

SMART Domains

Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
DEXDc	134	317	6.42e-34	SMART
HELICc	437	526	3.14e-19	SMART
Pfam:rRNA_proc-arch	580	839	1.7e-91	PFAM
DSHCT	863	1040	1.69e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000038574

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224176

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,522,354	I97N	probably damaging	Het
Acvrl1	A	G	15: 101,143,473	H502R	probably benign	Het
Adgrf4	T	C	17: 42,672,603	S63G	probably benign	Het
Agbl2	C	A	2: 90,791,555	L129I	probably damaging	Het
Ankrd11	C	A	8: 122,887,406	A2542S	probably damaging	Het
Armc9	A	G	1: 86,275,678	K818R	probably damaging	Het
Arsj	T	A	3: 126,438,236	C210*	probably null	Het
Aspscr1	C	T	11: 120,673,100	A11V	unknown	Het
Bicc1	G	T	10: 70,956,291	Q296K	possibly damaging	Het
Borcs5	A	C	6: 134,685,979	Q73P	probably benign	Het
Capn15	G	T	17: 25,963,432	D567E	probably damaging	Het
Catsperg1	A	C	7: 29,189,814	I866S	probably damaging	Het
Ccdc27	G	T	4: 154,041,817	H72N	unknown	Het
Ccser2	A	T	14: 36,879,500	M309K	possibly damaging	Het
Cd1d2	A	G	3: 86,987,101	S59G	probably benign	Het
Chml	G	A	1: 175,687,890	P155L	probably benign	Het
Csmd2	C	T	4: 128,452,458	P1504S		Het
Dcbld2	A	G	16: 58,448,718		probably null	Het
Ddx21	C	T	10: 62,598,243	E246K	probably benign	Het
Dis3l	A	C	9: 64,311,937	Y570*	probably null	Het
Dnah14	T	A	1: 181,770,054	Y3623N	probably benign	Het
Dock8	A	G	19: 25,175,400	D1610G	probably damaging	Het
Dync1h1	T	C	12: 110,630,625	S1669P	probably benign	Het
Eif2ak4	T	A	2: 118,417,283	I267N	possibly damaging	Het
Ern2	A	T	7: 122,170,241	V854E	probably damaging	Het
Fuca2	G	A	10: 13,507,430		probably null	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gm1110	T	A	9: 26,893,628	T380S	probably benign	Het
Gm13128	T	C	4: 144,332,741	F341L	probably benign	Het
Gm5788	A	C	12: 87,494,735	K5N	unknown	Het
Gm6460	A	T	5: 11,597,612	N106Y	probably damaging	Het
Golga2	G	A	2: 32,288,166	R29H	probably benign	Het
Grik5	T	C	7: 25,060,597	E259G	probably benign	Het
Grm3	T	C	5: 9,570,000	T415A	probably benign	Het
Gtf3c1	A	G	7: 125,645,670	Y1731H	probably damaging	Het
Hectd2	T	C	19: 36,612,403	C643R	probably damaging	Het
Hgfac	T	C	5: 35,042,628	S118P	probably damaging	Het
Hmcn1	A	G	1: 150,604,874	V4517A	probably benign	Het
Hnrnpc	A	T	14: 52,075,153	L290*	probably null	Het
Homer3	A	G	8: 70,289,413	E108G	probably damaging	Het
Hsd17b3	G	T	13: 64,072,002	S141R	probably benign	Het
Hspa12b	C	T	2: 131,138,476	T105I	probably damaging	Het
Ifi202b	T	C	1: 173,972,221	I231M	probably damaging	Het
Inhba	T	A	13: 16,017,637	N114K	probably benign	Het
Kmt2b	C	A	7: 30,569,410	M2631I	possibly damaging	Het
Loxhd1	C	T	18: 77,395,365	T1214I	probably damaging	Het
Lrp1	G	T	10: 127,546,862	N3683K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,363	K196R	probably benign	Het
Lrrn3	A	T	12: 41,452,911	M469K	probably benign	Het
Mafb	T	C	2: 160,365,829	E283G	probably damaging	Het
Mapt	C	A	11: 104,298,702	P182Q	probably benign	Het
Mmp14	G	T	14: 54,437,742	R277L	possibly damaging	Het
Mucl2	T	A	15: 103,897,445	N82I	probably benign	Het
Nsun6	T	A	2: 14,996,339	T469S	possibly damaging	Het
Olfr1076	A	C	2: 86,509,347	D296A	probably damaging	Het
Olfr1342	T	C	4: 118,689,642	D270G	possibly damaging	Het
Olfr507	G	C	7: 108,622,726	A305P	probably damaging	Het
Osbpl5	A	T	7: 143,694,933	F631I	possibly damaging	Het
Otud3	G	T	4: 138,901,885	D190E	possibly damaging	Het
Pcdhb6	A	T	18: 37,335,279	I418F	possibly damaging	Het
Per1	G	A	11: 69,106,513	R838H	probably damaging	Het
Per2	G	A	1: 91,435,135	P395S	probably damaging	Het
Per3	G	A	4: 151,018,058	Q583*	probably null	Het
Pkhd1l1	A	T	15: 44,550,761	H2808L	possibly damaging	Het
Ppfia2	A	G	10: 106,927,826	T1227A	probably benign	Het
Psg17	C	T	7: 18,817,094	D279N	probably benign	Het
Rnf167	A	G	11: 70,650,797	D235G	probably benign	Het
Rxfp3	A	G	15: 11,036,276	S337P	probably damaging	Het
Sall1	T	C	8: 89,033,158	D106G	possibly damaging	Het
Sema4f	A	G	6: 82,914,056	V590A	probably benign	Het
Setd1b	A	G	5: 123,157,757	D1102G	unknown	Het
Six2	C	A	17: 85,687,707	K82N	probably damaging	Het
Snx29	T	C	16: 11,400,942	M214T	probably benign	Het
Son	T	C	16: 91,658,922	L1519P	probably damaging	Het
Spin1	C	T	13: 51,149,049	S226L	probably benign	Het
Stxbp5l	T	C	16: 37,323,603	D131G	probably damaging	Het
Svep1	T	C	4: 58,069,422	Y2788C	probably damaging	Het
Tbl3	C	A	17: 24,701,976		probably null	Het
Themis	A	T	10: 28,781,702	I242L	possibly damaging	Het
Tmem203	G	A	2: 25,255,730	V21M	probably benign	Het
Trp53inp1	T	C	4: 11,169,750	C171R	probably benign	Het
Tsg101	A	G	7: 46,913,411	Y32H	probably damaging	Het
Tyw1	A	G	5: 130,274,706	D305G	probably damaging	Het
Vmn1r40	A	T	6: 89,715,044	Y281F	probably damaging	Het
Vmn2r105	T	A	17: 20,227,675	T296S	probably damaging	Het
Vmn2r13	T	C	5: 109,171,691		probably null	Het
Zfp933	A	G	4: 147,826,132	F336L	probably damaging	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	112952843	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	112947376	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5125:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	112940374	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	112964468	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	112952884	missense	possibly damaging	0.54
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAAGTGAGCGAGCCTTG -3'
(R):5'- TGCACTTCTGGCTCTGGAAG -3'

Sequencing Primer
(F):5'- GAGCCCCGCGTGACTTTTC -3'
(R):5'- TCTGGAAGCAGACACGGC -3'

Posted On

2019-10-17