Incidental Mutation 'R7555:Hnrnpc'
ID584725
Institutional Source Beutler Lab
Gene Symbol Hnrnpc
Ensembl Gene ENSMUSG00000060373
Gene Nameheterogeneous nuclear ribonucleoprotein C
SynonymshnRNP C2, Hnrpc1, Hnrpc2, D14Wsu171e, Hnrpc, hnRNPC2, hnRNPC1, hnRNP C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52073377-52104028 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 52075153 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 290 (L290*)
Ref Sequence ENSEMBL: ENSMUSP00000107237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111610] [ENSMUST00000164655] [ENSMUST00000227242] [ENSMUST00000227458] [ENSMUST00000227536] [ENSMUST00000228198] [ENSMUST00000228232] [ENSMUST00000228748]
Predicted Effect probably null
Transcript: ENSMUST00000111610
AA Change: L290*
SMART Domains Protein: ENSMUSP00000107237
Gene: ENSMUSG00000060373
AA Change: L290*

DomainStartEndE-ValueType
RRM 17 83 8.13e-15 SMART
low complexity region 112 121 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 210 225 N/A INTRINSIC
low complexity region 260 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164655
AA Change: L290*
SMART Domains Protein: ENSMUSP00000133052
Gene: ENSMUSG00000060373
AA Change: L290*

DomainStartEndE-ValueType
RRM 17 83 8.13e-15 SMART
low complexity region 112 121 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 210 225 N/A INTRINSIC
low complexity region 260 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000227242
AA Change: L277*
Predicted Effect probably null
Transcript: ENSMUST00000227458
AA Change: L269*
Predicted Effect probably null
Transcript: ENSMUST00000227536
AA Change: L277*
Predicted Effect probably null
Transcript: ENSMUST00000228198
AA Change: L283*
Predicted Effect probably null
Transcript: ENSMUST00000228232
AA Change: L270*
Predicted Effect probably null
Transcript: ENSMUST00000228748
AA Change: L270*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene can act as a tetramer and is involved in the assembly of 40S hnRNP particles. Multiple transcript variants encoding at least two different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele fail to undergo gastrulation, appear to arrest at the egg cylinder stage, and are resorbed at various times thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Hnrnpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Hnrnpc APN 14 52081873 missense probably null 0.01
IGL02654:Hnrnpc APN 14 52084117 missense probably damaging 0.98
IGL03248:Hnrnpc APN 14 52075439 intron probably benign
R0502:Hnrnpc UTSW 14 52075172 splice site probably benign
R1663:Hnrnpc UTSW 14 52075395 missense probably damaging 1.00
R4496:Hnrnpc UTSW 14 52075431 missense probably benign 0.10
R5191:Hnrnpc UTSW 14 52077507 missense probably damaging 1.00
R7570:Hnrnpc UTSW 14 52075099 missense possibly damaging 0.53
R8035:Hnrnpc UTSW 14 52084262 missense possibly damaging 0.95
R8860:Hnrnpc UTSW 14 52075335 missense possibly damaging 0.73
Z1177:Hnrnpc UTSW 14 52077429 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATGTGCAGAAGACCCCAGG -3'
(R):5'- GCGCCTCTGTGAAGAAAGATG -3'

Sequencing Primer
(F):5'- AGGGGAGATGACCTGGTGTTAC -3'
(R):5'- TCTGAGGCAGGTGCAGATGAC -3'
Posted On2019-10-17