Incidental Mutation 'R7555:Son'
ID 584733
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene Name Son DNA binding protein
Synonyms 2900011L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R7555 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 91647506-91679221 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91658922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1519 (L1519P)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
AlphaFold Q9QX47
Predicted Effect probably damaging
Transcript: ENSMUST00000114036
AA Change: L1519P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: L1519P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114037
AA Change: L1519P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: L1519P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117633
AA Change: L1519P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: L1519P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119368
AA Change: L1519P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: L1519P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
AA Change: L1519P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: L1519P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 splice site probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 splice site probably null
R2871:Son UTSW 16 91664317 splice site probably null
R2872:Son UTSW 16 91664317 splice site probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7928:Son UTSW 16 91656841 unclassified probably benign
R7972:Son UTSW 16 91660334 small deletion probably benign
R7978:Son UTSW 16 91660334 small deletion probably benign
R8000:Son UTSW 16 91660334 small deletion probably benign
R8192:Son UTSW 16 91655549 missense possibly damaging 0.91
R8221:Son UTSW 16 91656846 missense probably damaging 1.00
R8227:Son UTSW 16 91656691 unclassified probably benign
R8233:Son UTSW 16 91660334 small deletion probably benign
R8255:Son UTSW 16 91664936 missense unknown
R8292:Son UTSW 16 91656657 missense possibly damaging 0.93
R8407:Son UTSW 16 91660334 small deletion probably benign
R8468:Son UTSW 16 91656691 unclassified probably benign
R8495:Son UTSW 16 91660295 small deletion probably benign
R8772:Son UTSW 16 91657938 missense possibly damaging 0.65
R8796:Son UTSW 16 91660334 small deletion probably benign
R8862:Son UTSW 16 91656846 missense probably damaging 1.00
R8962:Son UTSW 16 91658169 missense possibly damaging 0.91
R8972:Son UTSW 16 91660334 small deletion probably benign
R8991:Son UTSW 16 91656478 missense probably benign 0.04
R8991:Son UTSW 16 91656720 missense possibly damaging 0.95
R9086:Son UTSW 16 91670530 missense unknown
R9138:Son UTSW 16 91655118 missense possibly damaging 0.80
R9232:Son UTSW 16 91656691 unclassified probably benign
R9241:Son UTSW 16 91657234 missense probably damaging 0.96
R9258:Son UTSW 16 91677682 missense unknown
R9328:Son UTSW 16 91655757 missense possibly damaging 0.67
R9420:Son UTSW 16 91657620 missense probably damaging 0.98
R9468:Son UTSW 16 91657551 missense possibly damaging 0.53
R9500:Son UTSW 16 91660334 small deletion probably benign
R9516:Son UTSW 16 91656691 unclassified probably benign
R9595:Son UTSW 16 91657353 missense possibly damaging 0.73
R9679:Son UTSW 16 91660334 small deletion probably benign
R9719:Son UTSW 16 91659552 missense probably damaging 0.96
R9749:Son UTSW 16 91656691 unclassified probably benign
R9772:Son UTSW 16 91660334 small deletion probably benign
R9782:Son UTSW 16 91647950 missense probably damaging 0.99
R9788:Son UTSW 16 91656811 unclassified probably benign
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTGGAACCAGCAGTATCAGTCC -3'
(R):5'- AGTAGCACACACTGTGTTATGC -3'

Sequencing Primer
(F):5'- AGCAGTATCAGTCCTTCAACCTG -3'
(R):5'- GCACACACTGTGTTATGCTCTGC -3'
Posted On 2019-10-17