Incidental Mutation 'R7555:Adgrf4'
ID584737
Institutional Source Beutler Lab
Gene Symbol Adgrf4
Ensembl Gene ENSMUSG00000023918
Gene Nameadhesion G protein-coupled receptor F4
Synonyms4632435A09Rik, Gpr115
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location42656891-42692284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42672603 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 63 (S63G)
Ref Sequence ENSEMBL: ENSMUSP00000024711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]
Predicted Effect probably benign
Transcript: ENSMUST00000024711
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: S63G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164524
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918
AA Change: S63G

DomainStartEndE-ValueType
SCOP:g1qd6.1 20 44 1e-2 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167993
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: S63G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170723
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: S63G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 9.2e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Adgrf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adgrf4 APN 17 42666656 missense probably damaging 1.00
IGL00474:Adgrf4 APN 17 42675759 missense probably damaging 0.97
IGL00913:Adgrf4 APN 17 42666902 missense possibly damaging 0.81
IGL02134:Adgrf4 APN 17 42669690 missense probably damaging 1.00
IGL02225:Adgrf4 APN 17 42663378 critical splice donor site probably null
IGL02423:Adgrf4 APN 17 42672576 missense probably benign 0.06
IGL02945:Adgrf4 APN 17 42667366 missense probably benign
R0329:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R0330:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R1595:Adgrf4 UTSW 17 42667873 missense probably benign 0.09
R1739:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1762:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1783:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1785:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2038:Adgrf4 UTSW 17 42667863 missense probably damaging 1.00
R2069:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2140:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2142:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2230:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2232:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2288:Adgrf4 UTSW 17 42667511 missense probably benign
R3107:Adgrf4 UTSW 17 42666867 nonsense probably null
R3732:Adgrf4 UTSW 17 42672581 missense probably damaging 1.00
R4003:Adgrf4 UTSW 17 42669759 missense probably damaging 1.00
R4158:Adgrf4 UTSW 17 42667677 missense probably benign
R4160:Adgrf4 UTSW 17 42667677 missense probably benign
R4163:Adgrf4 UTSW 17 42667586 missense probably benign
R4865:Adgrf4 UTSW 17 42667265 missense probably damaging 1.00
R4940:Adgrf4 UTSW 17 42666529 missense possibly damaging 0.90
R5411:Adgrf4 UTSW 17 42667213 missense probably damaging 1.00
R5512:Adgrf4 UTSW 17 42667285 missense probably benign 0.03
R6421:Adgrf4 UTSW 17 42672501 missense probably damaging 1.00
R7089:Adgrf4 UTSW 17 42666533 missense possibly damaging 0.95
R7261:Adgrf4 UTSW 17 42667435 missense probably benign 0.01
R7359:Adgrf4 UTSW 17 42667112 missense possibly damaging 0.78
R7502:Adgrf4 UTSW 17 42669657 missense possibly damaging 0.53
R7522:Adgrf4 UTSW 17 42669784 missense probably benign 0.04
R7567:Adgrf4 UTSW 17 42667442 missense probably benign
R7743:Adgrf4 UTSW 17 42672562 nonsense probably null
R8002:Adgrf4 UTSW 17 42667792 missense probably benign 0.05
X0027:Adgrf4 UTSW 17 42667528 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAAATGAAAGAGCACCTGCC -3'
(R):5'- CTCTGTCTGGACACTAGCTTCG -3'

Sequencing Primer
(F):5'- CCCCAATTCTGGAAGGGTTAG -3'
(R):5'- GGACACTAGCTTCGCCTTCG -3'
Posted On2019-10-17