Mutagenetix > Incidental Mutation

Incidental Mutation 'R7555:Adgrf4'

584737

Institutional Source

Beutler Lab

Gene Symbol

Adgrf4

Ensembl Gene

ENSMUSG00000023918

Gene Name

adhesion G protein-coupled receptor F4

Synonyms

4632435A09Rik, Gpr115

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7555 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42656891-42692284 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42672603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 63 (S63G)

Ref Sequence

ENSEMBL: ENSMUSP00000024711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024711
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: S63G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	103	112	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
GPS	349	400	1.25e-8	SMART
Pfam:7tm_2	402	653	5.9e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164524
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918
AA Change: S63G

Domain	Start	End	E-Value	Type
SCOP:g1qd6.1	20	44	1e-2	SMART
low complexity region	54	64	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167993
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: S63G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	103	112	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
GPS	349	400	1.25e-8	SMART
Pfam:7tm_2	402	653	5.9e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170723
AA Change: S63G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: S63G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	103	112	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
GPS	349	400	1.25e-8	SMART
Pfam:7tm_2	402	653	9.2e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,522,354	I97N	probably damaging	Het
Acvrl1	A	G	15: 101,143,473	H502R	probably benign	Het
Agbl2	C	A	2: 90,791,555	L129I	probably damaging	Het
Ankrd11	C	A	8: 122,887,406	A2542S	probably damaging	Het
Armc9	A	G	1: 86,275,678	K818R	probably damaging	Het
Arsj	T	A	3: 126,438,236	C210*	probably null	Het
Aspscr1	C	T	11: 120,673,100	A11V	unknown	Het
Bicc1	G	T	10: 70,956,291	Q296K	possibly damaging	Het
Borcs5	A	C	6: 134,685,979	Q73P	probably benign	Het
Capn15	G	T	17: 25,963,432	D567E	probably damaging	Het
Catsperg1	A	C	7: 29,189,814	I866S	probably damaging	Het
Ccdc27	G	T	4: 154,041,817	H72N	unknown	Het
Ccser2	A	T	14: 36,879,500	M309K	possibly damaging	Het
Cd1d2	A	G	3: 86,987,101	S59G	probably benign	Het
Chml	G	A	1: 175,687,890	P155L	probably benign	Het
Csmd2	C	T	4: 128,452,458	P1504S		Het
Dcbld2	A	G	16: 58,448,718		probably null	Het
Ddx21	C	T	10: 62,598,243	E246K	probably benign	Het
Dhx29	C	T	13: 112,927,642		probably benign	Het
Dis3l	A	C	9: 64,311,937	Y570*	probably null	Het
Dnah14	T	A	1: 181,770,054	Y3623N	probably benign	Het
Dock8	A	G	19: 25,175,400	D1610G	probably damaging	Het
Dync1h1	T	C	12: 110,630,625	S1669P	probably benign	Het
Eif2ak4	T	A	2: 118,417,283	I267N	possibly damaging	Het
Ern2	A	T	7: 122,170,241	V854E	probably damaging	Het
Fuca2	G	A	10: 13,507,430		probably null	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gm1110	T	A	9: 26,893,628	T380S	probably benign	Het
Gm13128	T	C	4: 144,332,741	F341L	probably benign	Het
Gm5788	A	C	12: 87,494,735	K5N	unknown	Het
Gm6460	A	T	5: 11,597,612	N106Y	probably damaging	Het
Golga2	G	A	2: 32,288,166	R29H	probably benign	Het
Grik5	T	C	7: 25,060,597	E259G	probably benign	Het
Grm3	T	C	5: 9,570,000	T415A	probably benign	Het
Gtf3c1	A	G	7: 125,645,670	Y1731H	probably damaging	Het
Hectd2	T	C	19: 36,612,403	C643R	probably damaging	Het
Hgfac	T	C	5: 35,042,628	S118P	probably damaging	Het
Hmcn1	A	G	1: 150,604,874	V4517A	probably benign	Het
Hnrnpc	A	T	14: 52,075,153	L290*	probably null	Het
Homer3	A	G	8: 70,289,413	E108G	probably damaging	Het
Hsd17b3	G	T	13: 64,072,002	S141R	probably benign	Het
Hspa12b	C	T	2: 131,138,476	T105I	probably damaging	Het
Ifi202b	T	C	1: 173,972,221	I231M	probably damaging	Het
Inhba	T	A	13: 16,017,637	N114K	probably benign	Het
Kmt2b	C	A	7: 30,569,410	M2631I	possibly damaging	Het
Loxhd1	C	T	18: 77,395,365	T1214I	probably damaging	Het
Lrp1	G	T	10: 127,546,862	N3683K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,363	K196R	probably benign	Het
Lrrn3	A	T	12: 41,452,911	M469K	probably benign	Het
Mafb	T	C	2: 160,365,829	E283G	probably damaging	Het
Mapt	C	A	11: 104,298,702	P182Q	probably benign	Het
Mmp14	G	T	14: 54,437,742	R277L	possibly damaging	Het
Mucl2	T	A	15: 103,897,445	N82I	probably benign	Het
Nsun6	T	A	2: 14,996,339	T469S	possibly damaging	Het
Olfr1076	A	C	2: 86,509,347	D296A	probably damaging	Het
Olfr1342	T	C	4: 118,689,642	D270G	possibly damaging	Het
Olfr507	G	C	7: 108,622,726	A305P	probably damaging	Het
Osbpl5	A	T	7: 143,694,933	F631I	possibly damaging	Het
Otud3	G	T	4: 138,901,885	D190E	possibly damaging	Het
Pcdhb6	A	T	18: 37,335,279	I418F	possibly damaging	Het
Per1	G	A	11: 69,106,513	R838H	probably damaging	Het
Per2	G	A	1: 91,435,135	P395S	probably damaging	Het
Per3	G	A	4: 151,018,058	Q583*	probably null	Het
Pkhd1l1	A	T	15: 44,550,761	H2808L	possibly damaging	Het
Ppfia2	A	G	10: 106,927,826	T1227A	probably benign	Het
Psg17	C	T	7: 18,817,094	D279N	probably benign	Het
Rnf167	A	G	11: 70,650,797	D235G	probably benign	Het
Rxfp3	A	G	15: 11,036,276	S337P	probably damaging	Het
Sall1	T	C	8: 89,033,158	D106G	possibly damaging	Het
Sema4f	A	G	6: 82,914,056	V590A	probably benign	Het
Setd1b	A	G	5: 123,157,757	D1102G	unknown	Het
Six2	C	A	17: 85,687,707	K82N	probably damaging	Het
Snx29	T	C	16: 11,400,942	M214T	probably benign	Het
Son	T	C	16: 91,658,922	L1519P	probably damaging	Het
Spin1	C	T	13: 51,149,049	S226L	probably benign	Het
Stxbp5l	T	C	16: 37,323,603	D131G	probably damaging	Het
Svep1	T	C	4: 58,069,422	Y2788C	probably damaging	Het
Tbl3	C	A	17: 24,701,976		probably null	Het
Themis	A	T	10: 28,781,702	I242L	possibly damaging	Het
Tmem203	G	A	2: 25,255,730	V21M	probably benign	Het
Trp53inp1	T	C	4: 11,169,750	C171R	probably benign	Het
Tsg101	A	G	7: 46,913,411	Y32H	probably damaging	Het
Tyw1	A	G	5: 130,274,706	D305G	probably damaging	Het
Vmn1r40	A	T	6: 89,715,044	Y281F	probably damaging	Het
Vmn2r105	T	A	17: 20,227,675	T296S	probably damaging	Het
Vmn2r13	T	C	5: 109,171,691		probably null	Het
Zfp933	A	G	4: 147,826,132	F336L	probably damaging	Het

Other mutations in Adgrf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Adgrf4	APN	17	42666656	missense	probably damaging	1.00
IGL00474:Adgrf4	APN	17	42675759	missense	probably damaging	0.97
IGL00913:Adgrf4	APN	17	42666902	missense	possibly damaging	0.81
IGL02134:Adgrf4	APN	17	42669690	missense	probably damaging	1.00
IGL02225:Adgrf4	APN	17	42663378	critical splice donor site	probably null
IGL02423:Adgrf4	APN	17	42672576	missense	probably benign	0.06
IGL02945:Adgrf4	APN	17	42667366	missense	probably benign
R0329:Adgrf4	UTSW	17	42667313	missense	probably damaging	1.00
R0330:Adgrf4	UTSW	17	42667313	missense	probably damaging	1.00
R1595:Adgrf4	UTSW	17	42667873	missense	probably benign	0.09
R1739:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R1762:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R1783:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R1785:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2038:Adgrf4	UTSW	17	42667863	missense	probably damaging	1.00
R2069:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2140:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2142:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2230:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2232:Adgrf4	UTSW	17	42666898	missense	possibly damaging	0.93
R2288:Adgrf4	UTSW	17	42667511	missense	probably benign
R3107:Adgrf4	UTSW	17	42666867	nonsense	probably null
R3732:Adgrf4	UTSW	17	42672581	missense	probably damaging	1.00
R4003:Adgrf4	UTSW	17	42669759	missense	probably damaging	1.00
R4158:Adgrf4	UTSW	17	42667677	missense	probably benign
R4160:Adgrf4	UTSW	17	42667677	missense	probably benign
R4163:Adgrf4	UTSW	17	42667586	missense	probably benign
R4865:Adgrf4	UTSW	17	42667265	missense	probably damaging	1.00
R4940:Adgrf4	UTSW	17	42666529	missense	possibly damaging	0.90
R5411:Adgrf4	UTSW	17	42667213	missense	probably damaging	1.00
R5512:Adgrf4	UTSW	17	42667285	missense	probably benign	0.03
R6421:Adgrf4	UTSW	17	42672501	missense	probably damaging	1.00
R7089:Adgrf4	UTSW	17	42666533	missense	possibly damaging	0.95
R7261:Adgrf4	UTSW	17	42667435	missense	probably benign	0.01
R7359:Adgrf4	UTSW	17	42667112	missense	possibly damaging	0.78
R7502:Adgrf4	UTSW	17	42669657	missense	possibly damaging	0.53
R7522:Adgrf4	UTSW	17	42669784	missense	probably benign	0.04
R7567:Adgrf4	UTSW	17	42667442	missense	probably benign
R7743:Adgrf4	UTSW	17	42672562	nonsense	probably null
R8002:Adgrf4	UTSW	17	42667792	missense	probably benign	0.05
R8210:Adgrf4	UTSW	17	42667550	missense	probably damaging	1.00
R8344:Adgrf4	UTSW	17	42666908	missense	probably benign	0.00
R8429:Adgrf4	UTSW	17	42667449	missense	probably benign
R9131:Adgrf4	UTSW	17	42667367	missense	probably benign	0.00
R9159:Adgrf4	UTSW	17	42662402	missense	probably benign
R9214:Adgrf4	UTSW	17	42667813	missense	possibly damaging	0.89
R9226:Adgrf4	UTSW	17	42669715	missense	probably damaging	1.00
R9237:Adgrf4	UTSW	17	42669891	missense	probably benign
R9546:Adgrf4	UTSW	17	42667392	nonsense	probably null
X0027:Adgrf4	UTSW	17	42667528	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGAAAATGAAAGAGCACCTGCC -3'
(R):5'- CTCTGTCTGGACACTAGCTTCG -3'

Sequencing Primer
(F):5'- CCCCAATTCTGGAAGGGTTAG -3'
(R):5'- GGACACTAGCTTCGCCTTCG -3'

Posted On

2019-10-17