Mutagenetix > Incidental Mutation

Incidental Mutation 'R7555:Loxhd1'

584740

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7555 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 77395365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1214 (T1214I)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: T1214I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: T1214I

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123410
AA Change: T348I

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: T348I

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148341
AA Change: T1105I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: T1105I

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (83/83)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,522,354	I97N	probably damaging	Het
Acvrl1	A	G	15: 101,143,473	H502R	probably benign	Het
Adgrf4	T	C	17: 42,672,603	S63G	probably benign	Het
Agbl2	C	A	2: 90,791,555	L129I	probably damaging	Het
Ankrd11	C	A	8: 122,887,406	A2542S	probably damaging	Het
Armc9	A	G	1: 86,275,678	K818R	probably damaging	Het
Arsj	T	A	3: 126,438,236	C210*	probably null	Het
Aspscr1	C	T	11: 120,673,100	A11V	unknown	Het
Bicc1	G	T	10: 70,956,291	Q296K	possibly damaging	Het
Borcs5	A	C	6: 134,685,979	Q73P	probably benign	Het
Capn15	G	T	17: 25,963,432	D567E	probably damaging	Het
Catsperg1	A	C	7: 29,189,814	I866S	probably damaging	Het
Ccdc27	G	T	4: 154,041,817	H72N	unknown	Het
Ccser2	A	T	14: 36,879,500	M309K	possibly damaging	Het
Cd1d2	A	G	3: 86,987,101	S59G	probably benign	Het
Chml	G	A	1: 175,687,890	P155L	probably benign	Het
Csmd2	C	T	4: 128,452,458	P1504S		Het
Dcbld2	A	G	16: 58,448,718		probably null	Het
Ddx21	C	T	10: 62,598,243	E246K	probably benign	Het
Dhx29	C	T	13: 112,927,642		probably benign	Het
Dis3l	A	C	9: 64,311,937	Y570*	probably null	Het
Dnah14	T	A	1: 181,770,054	Y3623N	probably benign	Het
Dock8	A	G	19: 25,175,400	D1610G	probably damaging	Het
Dync1h1	T	C	12: 110,630,625	S1669P	probably benign	Het
Eif2ak4	T	A	2: 118,417,283	I267N	possibly damaging	Het
Ern2	A	T	7: 122,170,241	V854E	probably damaging	Het
Fuca2	G	A	10: 13,507,430		probably null	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gm1110	T	A	9: 26,893,628	T380S	probably benign	Het
Gm13128	T	C	4: 144,332,741	F341L	probably benign	Het
Gm5788	A	C	12: 87,494,735	K5N	unknown	Het
Gm6460	A	T	5: 11,597,612	N106Y	probably damaging	Het
Golga2	G	A	2: 32,288,166	R29H	probably benign	Het
Grik5	T	C	7: 25,060,597	E259G	probably benign	Het
Grm3	T	C	5: 9,570,000	T415A	probably benign	Het
Gtf3c1	A	G	7: 125,645,670	Y1731H	probably damaging	Het
Hectd2	T	C	19: 36,612,403	C643R	probably damaging	Het
Hgfac	T	C	5: 35,042,628	S118P	probably damaging	Het
Hmcn1	A	G	1: 150,604,874	V4517A	probably benign	Het
Hnrnpc	A	T	14: 52,075,153	L290*	probably null	Het
Homer3	A	G	8: 70,289,413	E108G	probably damaging	Het
Hsd17b3	G	T	13: 64,072,002	S141R	probably benign	Het
Hspa12b	C	T	2: 131,138,476	T105I	probably damaging	Het
Ifi202b	T	C	1: 173,972,221	I231M	probably damaging	Het
Inhba	T	A	13: 16,017,637	N114K	probably benign	Het
Kmt2b	C	A	7: 30,569,410	M2631I	possibly damaging	Het
Lrp1	G	T	10: 127,546,862	N3683K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,363	K196R	probably benign	Het
Lrrn3	A	T	12: 41,452,911	M469K	probably benign	Het
Mafb	T	C	2: 160,365,829	E283G	probably damaging	Het
Mapt	C	A	11: 104,298,702	P182Q	probably benign	Het
Mmp14	G	T	14: 54,437,742	R277L	possibly damaging	Het
Mucl2	T	A	15: 103,897,445	N82I	probably benign	Het
Nsun6	T	A	2: 14,996,339	T469S	possibly damaging	Het
Olfr1076	A	C	2: 86,509,347	D296A	probably damaging	Het
Olfr1342	T	C	4: 118,689,642	D270G	possibly damaging	Het
Olfr507	G	C	7: 108,622,726	A305P	probably damaging	Het
Osbpl5	A	T	7: 143,694,933	F631I	possibly damaging	Het
Otud3	G	T	4: 138,901,885	D190E	possibly damaging	Het
Pcdhb6	A	T	18: 37,335,279	I418F	possibly damaging	Het
Per1	G	A	11: 69,106,513	R838H	probably damaging	Het
Per2	G	A	1: 91,435,135	P395S	probably damaging	Het
Per3	G	A	4: 151,018,058	Q583*	probably null	Het
Pkhd1l1	A	T	15: 44,550,761	H2808L	possibly damaging	Het
Ppfia2	A	G	10: 106,927,826	T1227A	probably benign	Het
Psg17	C	T	7: 18,817,094	D279N	probably benign	Het
Rnf167	A	G	11: 70,650,797	D235G	probably benign	Het
Rxfp3	A	G	15: 11,036,276	S337P	probably damaging	Het
Sall1	T	C	8: 89,033,158	D106G	possibly damaging	Het
Sema4f	A	G	6: 82,914,056	V590A	probably benign	Het
Setd1b	A	G	5: 123,157,757	D1102G	unknown	Het
Six2	C	A	17: 85,687,707	K82N	probably damaging	Het
Snx29	T	C	16: 11,400,942	M214T	probably benign	Het
Son	T	C	16: 91,658,922	L1519P	probably damaging	Het
Spin1	C	T	13: 51,149,049	S226L	probably benign	Het
Stxbp5l	T	C	16: 37,323,603	D131G	probably damaging	Het
Svep1	T	C	4: 58,069,422	Y2788C	probably damaging	Het
Tbl3	C	A	17: 24,701,976		probably null	Het
Themis	A	T	10: 28,781,702	I242L	possibly damaging	Het
Tmem203	G	A	2: 25,255,730	V21M	probably benign	Het
Trp53inp1	T	C	4: 11,169,750	C171R	probably benign	Het
Tsg101	A	G	7: 46,913,411	Y32H	probably damaging	Het
Tyw1	A	G	5: 130,274,706	D305G	probably damaging	Het
Vmn1r40	A	T	6: 89,715,044	Y281F	probably damaging	Het
Vmn2r105	T	A	17: 20,227,675	T296S	probably damaging	Het
Vmn2r13	T	C	5: 109,171,691		probably null	Het
Zfp933	A	G	4: 147,826,132	F336L	probably damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGGCTAGAAAGGGTCCC -3'
(R):5'- TTCTGTGCAGCAAAGGCCAC -3'

Sequencing Primer
(F):5'- AGAAAGGGTCCCTGTGTCTTCATAC -3'
(R):5'- GCAAAGGCCACTGCTCCTC -3'

Posted On

2019-10-17