Incidental Mutation 'R7556:Ppp1r42'
ID584743
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Nameprotein phosphatase 1, regulatory subunit 42
Synonyms1700011J18Rik, 4930418G15Rik, Lrrc67
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location9968624-10009136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9995183 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 172 (H172R)
Ref Sequence ENSEMBL: ENSMUSP00000027049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
Predicted Effect probably benign
Transcript: ENSMUST00000027049
AA Change: H172R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: H172R

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124874
AA Change: H172R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: H172R

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130102
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176398
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10003233 critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 9968853 missense probably benign 0.34
G1patch:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R0920:Ppp1r42 UTSW 1 9999525 missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10000086 missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10003347 missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10003412 intron probably benign
R4828:Ppp1r42 UTSW 1 9999411 missense probably benign
R4863:Ppp1r42 UTSW 1 10003386 intron probably benign
R5384:Ppp1r42 UTSW 1 9999435 missense probably damaging 1.00
R5394:Ppp1r42 UTSW 1 9999405 missense probably damaging 1.00
R6725:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 9968857 missense probably benign
R8722:Ppp1r42 UTSW 1 9985669 missense probably benign 0.15
Z1177:Ppp1r42 UTSW 1 9999427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACGTATGAAGACCTTGGG -3'
(R):5'- ACCTGGGCTGATGCTTTGAAG -3'

Sequencing Primer
(F):5'- TGACGTATGAAGACCTTGGGTATAG -3'
(R):5'- GCTTTTAAAGACCTGAGACCTGAGTC -3'
Posted On2019-10-17