Incidental Mutation 'R7556:Setx'
ID584748
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29146493 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 997 (Q997K)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061578
AA Change: Q997K

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: Q997K

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7646:Setx UTSW 2 29177549 missense possibly damaging 0.94
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGACAGGTGCCTCATGAC -3'
(R):5'- TTCAGAGTCTTCAAATTCTACAGGG -3'

Sequencing Primer
(F):5'- CTCATGACAGTAGCAAGCCTTTGG -3'
(R):5'- GGTACCTTTCTTCCTCTTTTACAAG -3'
Posted On2019-10-17