Incidental Mutation 'R7556:Celf3'
ID584751
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94480283 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 54 (T54M)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000199884] [ENSMUST00000200342]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: T54M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: T54M

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: T54M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: T54M

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: T54M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: T54M

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCATCAACAGAGCAAATGC -3'
(R):5'- ATAGCTCGGTGTCCTAGGAG -3'

Sequencing Primer
(F):5'- GCAAATGCTCTCCCACGTC -3'
(R):5'- GAGTCTTCTGTTCGTGCA -3'
Posted On2019-10-17