Incidental Mutation 'R7556:Atp1a3'
ID584766
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene NameATPase, Na+/K+ transporting, alpha 3 polypeptide
SynonymsAtpa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24978167-25005958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24981566 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 832 (D832G)
Ref Sequence ENSEMBL: ENSMUSP00000079691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
Predicted Effect probably benign
Transcript: ENSMUST00000080882
AA Change: D832G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: D832G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102858
AA Change: D832G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: D832G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196684
AA Change: D845G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: D845G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
clonic UTSW 7 24987985 missense probably benign 0.37
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R4963:Atp1a3 UTSW 7 24994626 missense probably damaging 0.97
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5294:Atp1a3 UTSW 7 24988048 missense probably damaging 0.98
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7165:Atp1a3 UTSW 7 24978965 missense probably benign 0.13
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7301:Atp1a3 UTSW 7 24990515 missense probably benign 0.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7943:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7944:Atp1a3 UTSW 7 25001148 missense unknown
R8002:Atp1a3 UTSW 7 25000671 missense probably damaging 1.00
R8010:Atp1a3 UTSW 7 24980645 missense possibly damaging 0.90
Z1176:Atp1a3 UTSW 7 24998688 missense probably benign 0.00
Z1177:Atp1a3 UTSW 7 24980119 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGAGGAGTCTCGACTTTGG -3'
(R):5'- TGGCTGCTACTAAAGGCTGG -3'

Sequencing Primer
(F):5'- AGTCTCGACTTTGGTTGCTTC -3'
(R):5'- CTGCTACTAAAGGCTGGAGAGG -3'
Posted On2019-10-17