Incidental Mutation 'R0617:Lrrk2'
ID 58477
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 038806-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975
Essential gene? Possibly essential (E-score: 0.533) question?
Stock # R0617 (G1)
Quality Score 223
Status Validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91752278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1485 (Y1485F)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: Y1485F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: Y1485F

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Meta Mutation Damage Score 0.1768 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik C A 19: 11,112,400 L40F probably damaging Het
4930555F03Rik A T 8: 49,500,492 noncoding transcript Het
A630073D07Rik T C 6: 132,626,737 probably benign Het
Abca16 G A 7: 120,433,611 probably benign Het
Abca5 A T 11: 110,279,689 D1265E probably damaging Het
Abcf1 C T 17: 35,961,187 V312I probably benign Het
Abhd12 T A 2: 150,846,365 probably null Het
Adam23 A G 1: 63,543,147 H318R probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Adgrf3 T C 5: 30,195,080 T972A probably benign Het
Adipoq T A 16: 23,155,410 D62E probably damaging Het
Akap2 T C 4: 57,829,434 probably benign Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Arap2 AT ATT 5: 62,649,907 probably benign Het
Arhgef28 G T 13: 97,970,355 T687K probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
Atad2b C A 12: 4,937,401 D76E probably benign Het
Atm A T 9: 53,458,941 Y2290* probably null Het
Atrn T A 2: 130,995,085 probably null Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Bsn T C 9: 108,107,240 E3205G unknown Het
Cacna1c T C 6: 118,602,213 Y1599C probably damaging Het
Ccdc40 A G 11: 119,242,804 D590G probably damaging Het
Ccdc68 A G 18: 69,946,552 probably null Het
Ccdc97 G A 7: 25,714,420 R279C probably damaging Het
Ccm2l A G 2: 153,070,900 T120A probably damaging Het
Cfap54 T C 10: 92,829,650 probably benign Het
Cfh A G 1: 140,100,883 S1043P probably benign Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Cib2 T C 9: 54,554,496 D26G possibly damaging Het
Col24a1 T C 3: 145,314,120 V84A probably damaging Het
Csn3 T C 5: 87,929,871 Y79H probably benign Het
Ddx47 T A 6: 135,017,122 V149E probably damaging Het
Dennd5b A T 6: 149,033,262 probably benign Het
Desi1 T C 15: 81,998,198 N109D probably damaging Het
Fam13c T C 10: 70,536,352 probably benign Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fanca A G 8: 123,288,070 F831S probably damaging Het
Fancm C T 12: 65,097,317 R518* probably null Het
Fat2 A G 11: 55,311,843 V135A possibly damaging Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Fgd3 A T 13: 49,264,697 V631E possibly damaging Het
Fhod3 G A 18: 25,112,679 probably benign Het
Focad T C 4: 88,121,288 probably benign Het
Foxn4 C A 5: 114,261,068 probably benign Het
Gm1673 T C 5: 33,983,552 probably benign Het
Gm2381 A T 7: 42,819,978 C241S probably damaging Het
Gm6483 T G 8: 19,693,709 F117V probably damaging Het
Hectd4 T C 5: 121,343,232 probably benign Het
Hecw1 T A 13: 14,280,442 Q676L probably benign Het
Hipk2 G A 6: 38,747,485 R437C possibly damaging Het
Ifnar1 T C 16: 91,501,682 Y396H probably damaging Het
Ints5 A T 19: 8,896,019 K447N probably damaging Het
Iqsec1 T C 6: 90,689,970 Y495C probably damaging Het
Itga5 C T 15: 103,356,315 probably null Het
Kcnk4 T A 19: 6,928,160 probably benign Het
Kmo A G 1: 175,647,190 T174A possibly damaging Het
Krt36 T C 11: 100,102,275 D458G probably damaging Het
Krtap16-1 G T 11: 99,986,495 P28T probably damaging Het
Lama3 T C 18: 12,419,258 probably null Het
Lrrc9 T C 12: 72,483,014 S920P probably damaging Het
Mical1 C T 10: 41,481,315 A372V probably damaging Het
Mtr C T 13: 12,221,432 R636Q probably benign Het
Muc4 A T 16: 32,752,107 T662S possibly damaging Het
Myo10 G A 15: 25,738,005 V546M probably damaging Het
Nbeal1 G A 1: 60,281,832 W2034* probably null Het
Nhlrc3 T C 3: 53,458,623 T150A probably damaging Het
Nkx2-1 T C 12: 56,534,855 H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 noncoding transcript Het
Nod2 A G 8: 88,653,231 N120S probably benign Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1124 A G 2: 87,434,661 D58G probably damaging Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr1459 T C 19: 13,146,363 M99V probably benign Het
Olfr1477 C A 19: 13,502,536 N64K probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr640 A T 7: 104,021,989 S110T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pcdhb8 C T 18: 37,357,047 R593C probably benign Het
Pgm3 A G 9: 86,556,190 probably null Het
Pirt T A 11: 66,926,172 V103E probably damaging Het
Plxnc1 T A 10: 94,799,368 D1332V probably damaging Het
Ppfia4 A T 1: 134,328,780 V122E probably damaging Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prmt2 C T 10: 76,208,683 probably benign Het
Prrc2a G T 17: 35,153,560 P1702T probably damaging Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Rb1cc1 T A 1: 6,248,790 I794K possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Sbf2 ACC AC 7: 110,330,683 probably null Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Setx T A 2: 29,146,807 H1101Q possibly damaging Het
Sis A G 3: 72,965,605 C67R probably damaging Het
Skint1 T A 4: 112,029,399 probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata31d1a A T 13: 59,702,259 I685N possibly damaging Het
Spef2 T A 15: 9,592,758 N1499I probably damaging Het
Stk11ip T A 1: 75,532,288 probably null Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Svil T C 18: 5,117,002 S2059P probably damaging Het
Syne1 C T 10: 5,350,933 V932M probably damaging Het
Tacc1 A C 8: 25,178,004 probably benign Het
Tbc1d13 C A 2: 30,135,564 probably benign Het
Tbc1d15 A C 10: 115,239,299 D59E probably damaging Het
Tcaf2 A G 6: 42,642,511 F194S probably damaging Het
Terf2ip T A 8: 112,011,495 M5K probably benign Het
Tgfbr2 A T 9: 116,158,320 D40E probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmprss3 A T 17: 31,193,912 C129S probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Tnr A G 1: 159,868,103 D532G probably damaging Het
Tnrc18 T A 5: 142,776,739 H465L unknown Het
Togaram2 A T 17: 71,700,509 Q350L possibly damaging Het
Topaz1 G A 9: 122,749,906 C627Y possibly damaging Het
Tpx2 A T 2: 152,873,138 Q93L probably benign Het
Trim54 T C 5: 31,136,182 probably null Het
Troap T A 15: 99,082,660 C574S probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r51 A G 7: 10,100,469 V214A possibly damaging Het
Vmn2r66 A T 7: 84,995,276 M642K probably benign Het
Vwa5a T A 9: 38,723,895 I232N probably damaging Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp820 A T 17: 21,819,704 S214R probably damaging Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Zgrf1 C T 3: 127,588,038 T1162M probably benign Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91723162 missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
R9605:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91812324 missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91787048 missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91765681 missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91750279 nonsense probably null
R9728:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91811026 missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGTTCCTGTGAGGACCTTCAAACG -3'
(R):5'- TAACTAGCAGCCTGCAAGAGGCAC -3'

Sequencing Primer
(F):5'- GTCACACGGTTGCATTTCAAG -3'
(R):5'- TGCAAGAGGCACACACTCG -3'
Posted On 2013-07-11