Incidental Mutation 'R7556:Mapt'
ID584791
Institutional Source Beutler Lab
Gene Symbol Mapt
Ensembl Gene ENSMUSG00000018411
Gene Namemicrotubule-associated protein tau
SynonymsMtapt, Tau
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location104231390-104332090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104298702 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 182 (P182Q)
Ref Sequence ENSEMBL: ENSMUSP00000102602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100347] [ENSMUST00000106988] [ENSMUST00000106989] [ENSMUST00000106992] [ENSMUST00000106993] [ENSMUST00000132245] [ENSMUST00000132977] [ENSMUST00000145227]
Predicted Effect probably benign
Transcript: ENSMUST00000100347
SMART Domains Protein: ENSMUSP00000097919
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 127 139 N/A INTRINSIC
low complexity region 163 212 N/A INTRINSIC
Pfam:Tubulin-binding 232 263 1.4e-18 PFAM
Pfam:Tubulin-binding 264 294 3.3e-21 PFAM
Pfam:Tubulin-binding 295 325 1.6e-19 PFAM
Pfam:Tubulin-binding 326 357 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106988
AA Change: P166Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102601
Gene: ENSMUSG00000018411
AA Change: P166Q

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 466 515 N/A INTRINSIC
Pfam:Tubulin-binding 535 566 3.5e-19 PFAM
Pfam:Tubulin-binding 567 597 8.6e-22 PFAM
Pfam:Tubulin-binding 598 628 4e-20 PFAM
Pfam:Tubulin-binding 629 660 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106989
AA Change: P182Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102602
Gene: ENSMUSG00000018411
AA Change: P182Q

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 482 531 N/A INTRINSIC
Pfam:Tubulin-binding 552 582 1.7e-13 PFAM
Pfam:Tubulin-binding 583 613 6.8e-20 PFAM
Pfam:Tubulin-binding 614 644 2.3e-17 PFAM
Pfam:Tubulin-binding 645 676 3.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106992
SMART Domains Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 105 154 N/A INTRINSIC
Pfam:Tubulin-binding 174 205 6.1e-19 PFAM
Pfam:Tubulin-binding 206 236 1.5e-21 PFAM
Pfam:Tubulin-binding 237 267 6.9e-20 PFAM
Pfam:Tubulin-binding 268 299 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106993
SMART Domains Protein: ENSMUSP00000102606
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 140 172 N/A INTRINSIC
Pfam:Tubulin-binding 192 223 4.6e-19 PFAM
Pfam:Tubulin-binding 224 254 1.1e-21 PFAM
Pfam:Tubulin-binding 255 285 5.3e-20 PFAM
Pfam:Tubulin-binding 286 317 3.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132245
Predicted Effect probably benign
Transcript: ENSMUST00000132977
SMART Domains Protein: ENSMUSP00000123260
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145227
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit altered performance in behavioral tests and show mircotubule changes in small-calibre axons. Embryonic hippocampal cultures from mutants exhibit delayed axonal and neuritic maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Mapt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Mapt APN 11 104322485 missense probably damaging 1.00
IGL00473:Mapt APN 11 104287183 missense probably damaging 1.00
IGL01599:Mapt APN 11 104294915 missense probably damaging 1.00
IGL01862:Mapt APN 11 104290002 intron probably benign
IGL02315:Mapt APN 11 104328078 missense probably damaging 0.99
IGL03369:Mapt APN 11 104282433 missense probably damaging 1.00
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R1913:Mapt UTSW 11 104328075 missense probably damaging 1.00
R1918:Mapt UTSW 11 104298499 missense probably benign 0.26
R3423:Mapt UTSW 11 104298722 nonsense probably null
R3425:Mapt UTSW 11 104298722 nonsense probably null
R3831:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R3833:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R4095:Mapt UTSW 11 104310536 critical splice donor site probably null
R4814:Mapt UTSW 11 104298960 missense probably benign 0.04
R4890:Mapt UTSW 11 104328149 missense probably damaging 1.00
R5613:Mapt UTSW 11 104302390 missense possibly damaging 0.82
R6415:Mapt UTSW 11 104298998 missense probably benign 0.01
R6956:Mapt UTSW 11 104318255 splice site probably null
R7395:Mapt UTSW 11 104328123 missense probably damaging 0.99
R7406:Mapt UTSW 11 104322524 missense possibly damaging 0.94
R7547:Mapt UTSW 11 104322312 intron probably null
R7554:Mapt UTSW 11 104298702 missense probably benign 0.09
R7555:Mapt UTSW 11 104298702 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGTTTGCTTGTCGAACCAGG -3'
(R):5'- TCTGCGGAGACTTTGGAGAAG -3'

Sequencing Primer
(F):5'- TTGTCGAACCAGGGCGTC -3'
(R):5'- GGACGGAACCCTCAGTTG -3'
Posted On2019-10-17