Incidental Mutation 'R7556:Fbxl21'
ID584797
Institutional Source Beutler Lab
Gene Symbol Fbxl21
Ensembl Gene ENSMUSG00000035509
Gene NameF-box and leucine-rich repeat protein 21
SynonymsD630045D17Rik, FBL3B, FBXL3B, Psttm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location56522472-56537898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56526928 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 31 (N31Y)
Ref Sequence ENSEMBL: ENSMUSP00000112518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000121095] [ENSMUST00000121871] [ENSMUST00000124981] [ENSMUST00000128668]
Predicted Effect probably benign
Transcript: ENSMUST00000045428
AA Change: N5Y

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509
AA Change: N5Y

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000121095
AA Change: N31Y

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112714
Gene: ENSMUSG00000035509
AA Change: N31Y

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121871
AA Change: N31Y

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509
AA Change: N31Y

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124981
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice with a point mutation exhibit a short circadian free-running period in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Fbxl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Fbxl21 APN 13 56527709 splice site probably benign
IGL01972:Fbxl21 APN 13 56536859 nonsense probably null
IGL02450:Fbxl21 APN 13 56526953 missense possibly damaging 0.52
IGL02667:Fbxl21 APN 13 56537129 missense probably benign 0.07
IGL02945:Fbxl21 APN 13 56527170 missense probably damaging 1.00
R1535:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R1741:Fbxl21 UTSW 13 56537102 missense probably benign 0.06
R1863:Fbxl21 UTSW 13 56527063 missense probably benign 0.01
R1886:Fbxl21 UTSW 13 56527093 missense probably benign 0.24
R3176:Fbxl21 UTSW 13 56537122 nonsense probably null
R3276:Fbxl21 UTSW 13 56537122 nonsense probably null
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3733:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R4535:Fbxl21 UTSW 13 56527060 missense probably damaging 0.99
R4678:Fbxl21 UTSW 13 56537049 missense probably damaging 1.00
R5264:Fbxl21 UTSW 13 56532323 missense probably benign 0.17
R5640:Fbxl21 UTSW 13 56537381 missense probably benign 0.23
R5714:Fbxl21 UTSW 13 56527072 missense probably benign 0.29
R6640:Fbxl21 UTSW 13 56537009 missense probably damaging 1.00
R6989:Fbxl21 UTSW 13 56527061 missense probably damaging 1.00
R7140:Fbxl21 UTSW 13 56532332 missense probably damaging 1.00
R7180:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R7760:Fbxl21 UTSW 13 56526934 missense probably benign 0.00
R7760:Fbxl21 UTSW 13 56537003 missense probably benign
R7911:Fbxl21 UTSW 13 56537163 missense probably damaging 0.99
R7992:Fbxl21 UTSW 13 56537163 missense probably damaging 0.99
X0019:Fbxl21 UTSW 13 56532429 missense possibly damaging 0.82
X0026:Fbxl21 UTSW 13 56527112 missense probably damaging 1.00
Z1176:Fbxl21 UTSW 13 56527003 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCACCAATCAATGCGTGG -3'
(R):5'- CTCCAAAGATCAGGGATGTGG -3'

Sequencing Primer
(F):5'- CACCAATCAATGCGTGGAATGTAAG -3'
(R):5'- GCCCGGGCTCGATCTATTAAAG -3'
Posted On2019-10-17