Incidental Mutation 'R7556:Brd9'
ID584799
Institutional Source Beutler Lab
Gene Symbol Brd9
Ensembl Gene ENSMUSG00000057649
Gene Namebromodomain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location73937811-73960895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73944767 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 292 (D292G)
Ref Sequence ENSEMBL: ENSMUSP00000096982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099384] [ENSMUST00000222399] [ENSMUST00000222749] [ENSMUST00000223238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099384
AA Change: D292G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096982
Gene: ENSMUSG00000057649
AA Change: D292G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
coiled coil region 53 104 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
BROMO 134 242 1.52e-30 SMART
low complexity region 249 264 N/A INTRINSIC
Pfam:DUF3512 274 505 1.6e-82 PFAM
low complexity region 544 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222399
AA Change: D291G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222749
Predicted Effect probably benign
Transcript: ENSMUST00000223238
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Brd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Brd9 APN 13 73938547 missense probably damaging 0.98
IGL01461:Brd9 APN 13 73951598 nonsense probably null
IGL01928:Brd9 APN 13 73955511 missense probably benign 0.02
R0379:Brd9 UTSW 13 73942683 splice site probably benign
R0420:Brd9 UTSW 13 73955473 missense probably benign
R0788:Brd9 UTSW 13 73944867 splice site probably benign
R1539:Brd9 UTSW 13 73944743 missense probably damaging 0.99
R4095:Brd9 UTSW 13 73944799 missense probably benign 0.19
R4582:Brd9 UTSW 13 73947733 missense probably benign 0.00
R4648:Brd9 UTSW 13 73940776 missense probably benign 0.37
R4915:Brd9 UTSW 13 73938455 missense probably damaging 0.99
R6054:Brd9 UTSW 13 73940741 missense probably damaging 1.00
R6175:Brd9 UTSW 13 73960314 missense probably damaging 0.98
R6462:Brd9 UTSW 13 73940669 missense probably damaging 1.00
R6520:Brd9 UTSW 13 73942794 missense probably benign 0.00
R7217:Brd9 UTSW 13 73938944 missense probably damaging 1.00
R7360:Brd9 UTSW 13 73944823 missense probably benign 0.07
R7422:Brd9 UTSW 13 73954578 missense probably benign
R7844:Brd9 UTSW 13 73938533 missense probably damaging 1.00
R7927:Brd9 UTSW 13 73938533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGATCAGAGCATGTAGGGATG -3'
(R):5'- ATTCCAAGTTCAGGCCAGACC -3'

Sequencing Primer
(F):5'- CATGTAGGGATGCTATGGGAC -3'
(R):5'- CTCCCAATTTTGATGGAGATACCTG -3'
Posted On2019-10-17