Incidental Mutation 'R7556:Golgb1'
ID584802
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36915793 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1842 (M1842L)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: M1842L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: M1842L

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: M1801L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: M1801L

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Tulp2 A G 7: 45,518,581 probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7930:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7988:Golgb1 UTSW 16 36913685 missense probably benign
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACGAGATGCTCTGAGTG -3'
(R):5'- TGCCAGTTGATTCATCAGCC -3'

Sequencing Primer
(F):5'- TGACAGTGCCAAGCTTGAAGATTC -3'
(R):5'- GATTCATCAGCCTCTCCTCTAAATCG -3'
Posted On2019-10-17