Incidental Mutation 'R7557:Tcea1'
ID584817
Institutional Source Beutler Lab
Gene Symbol Tcea1
Ensembl Gene ENSMUSG00000033813
Gene Nametranscription elongation factor A (SII) 1
SynonymsS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location4857814-4897909 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4894990 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 294 (C294*)
Ref Sequence ENSEMBL: ENSMUSP00000080266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081551] [ENSMUST00000165720]
Predicted Effect probably null
Transcript: ENSMUST00000081551
AA Change: C294*
SMART Domains Protein: ENSMUSP00000080266
Gene: ENSMUSG00000033813
AA Change: C294*

DomainStartEndE-ValueType
TFS2N 5 79 2.56e-31 SMART
low complexity region 83 93 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
TFS2M 138 239 1.32e-44 SMART
ZnF_C2C2 261 300 3.6e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165720
AA Change: C305*
SMART Domains Protein: ENSMUSP00000129157
Gene: ENSMUSG00000033813
AA Change: C305*

DomainStartEndE-ValueType
Pfam:Med26 38 88 1.1e-18 PFAM
low complexity region 94 104 N/A INTRINSIC
low complexity region 111 126 N/A INTRINSIC
TFS2M 149 250 1.32e-44 SMART
ZnF_C2C2 272 311 3.6e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired definitive erythropoiesis with loss of late stage erythroblasts, fetal liver hypoplasia, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Tcea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Tcea1 APN 1 4896347 splice site probably benign
IGL02361:Tcea1 APN 1 4896347 splice site probably benign
IGL02367:Tcea1 APN 1 4878133 critical splice donor site probably null
IGL02813:Tcea1 APN 1 4886756 missense probably benign 0.06
R0403:Tcea1 UTSW 1 4889503 missense probably benign
R0707:Tcea1 UTSW 1 4880346 intron probably benign
R1157:Tcea1 UTSW 1 4889447 splice site probably null
R3702:Tcea1 UTSW 1 4894935 missense probably benign 0.06
R4541:Tcea1 UTSW 1 4893436 missense probably damaging 1.00
R4764:Tcea1 UTSW 1 4894944 missense probably damaging 1.00
R5428:Tcea1 UTSW 1 4880345 intron probably benign
R6005:Tcea1 UTSW 1 4890773 missense probably benign 0.03
R6661:Tcea1 UTSW 1 4858429 intron probably benign
R6792:Tcea1 UTSW 1 4892045 missense probably benign 0.00
R7215:Tcea1 UTSW 1 4867483 missense probably damaging 0.98
R7635:Tcea1 UTSW 1 4889551 missense probably benign 0.01
R8033:Tcea1 UTSW 1 4891918 missense probably damaging 0.98
R8955:Tcea1 UTSW 1 4889509 missense probably benign 0.00
Z1177:Tcea1 UTSW 1 4857977 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACATCTTAAGGTAATATCACTGGAG -3'
(R):5'- AACTTGCTTGTATGAGACGAAC -3'

Sequencing Primer
(F):5'- GTAGAATGCTCTTATATGGGTT -3'
(R):5'- TGTTTACTGAAAAGCTACAAACCC -3'
Posted On2019-10-17