Incidental Mutation 'R7557:Chp1'
ID584822
Institutional Source Beutler Lab
Gene Symbol Chp1
Ensembl Gene ENSMUSG00000014077
Gene Namecalcineurin-like EF hand protein 1
Synonymsvac, Sid470p, 1500003O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.570) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location119547697-119587027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119560757 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 32 (Y32N)
Ref Sequence ENSEMBL: ENSMUSP00000014221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014221] [ENSMUST00000119172] [ENSMUST00000132448]
Predicted Effect probably damaging
Transcript: ENSMUST00000014221
AA Change: Y32N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014221
Gene: ENSMUSG00000014077
AA Change: Y32N

DomainStartEndE-ValueType
Blast:EFh 30 58 8e-7 BLAST
EFh 114 142 4.81e-4 SMART
EFh 155 183 6.16e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119172
AA Change: Y32N

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114013
Gene: ENSMUSG00000014077
AA Change: Y32N

DomainStartEndE-ValueType
Pfam:EF-hand_6 30 63 2.1e-4 PFAM
EFh 114 142 4.81e-4 SMART
EFh 155 183 5.08e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132448
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein that binds to the Na+/H+ exchanger NHE1. This protein serves as an essential cofactor which supports the physiological activity of NHE family members and may play a role in the mitogenic regulation of NHE1. The protein shares similarity with calcineurin B and calmodulin and it is also known to be an endogenous inhibitor of calcineurin activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation display ataxia and progressive Purkinje cell axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Chp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03077:Chp1 APN 2 119584600 missense probably benign 0.00
R0470:Chp1 UTSW 2 119560763 missense probably damaging 1.00
R0497:Chp1 UTSW 2 119571782 missense possibly damaging 0.49
R5875:Chp1 UTSW 2 119571815 missense probably damaging 1.00
R6551:Chp1 UTSW 2 119571813 missense possibly damaging 0.92
R7633:Chp1 UTSW 2 119560745 missense probably benign 0.00
R7689:Chp1 UTSW 2 119584665 missense probably benign 0.04
R8179:Chp1 UTSW 2 119547772 unclassified probably benign
RF004:Chp1 UTSW 2 119580714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAGTTTTCATTGATTTAGTTTCT -3'
(R):5'- GTGGCTACCCTTGGAATATAGC -3'

Sequencing Primer
(F):5'- AGTTTCTTCTCTAGCTCTTCTTACTC -3'
(R):5'- CCTTGGAATATAGCTCCTAGGGATC -3'
Posted On2019-10-17