Incidental Mutation 'R7557:Vmn2r7'
ID584824
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64724973 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 23 (Y23H)
Ref Sequence ENSEMBL: ENSMUSP00000124192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972]
Predicted Effect probably benign
Transcript: ENSMUST00000161972
AA Change: Y23H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: Y23H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
R8814:Vmn2r7 UTSW 3 64716563 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACTTACCCCTCACACATGGG -3'
(R):5'- AATTGCAAGTGACTGTGACATCTG -3'

Sequencing Primer
(F):5'- GGGTGATTCTATTTCCTCATCAGAG -3'
(R):5'- TTAATTAGTCAAGAGCAGCAAGC -3'
Posted On2019-10-17