Mutagenetix > Incidental Mutations

Incidental Mutation 'R7557:1110002E22Rik'

584828

Institutional Source

Beutler Lab

Gene Symbol

1110002E22Rik

Ensembl Gene

ENSMUSG00000090066

Gene Name

RIKEN cDNA 1110002E22 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.391) question?

Stock #

R7557 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

138065052-138081506 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 138068283 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1078 (Q1078*)

Ref Sequence

ENSEMBL: ENSMUSP00000123851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]

Predicted Effect

probably benign
Transcript: ENSMUST00000053318

Predicted Effect

probably null
Transcript: ENSMUST00000163080
AA Change: Q1078*

SMART Domains

Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: Q1078*

Domain	Start	End	E-Value	Type
low complexity region	44	55	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
low complexity region	422	438	N/A	INTRINSIC
low complexity region	459	505	N/A	INTRINSIC
low complexity region	667	680	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	995	1007	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
low complexity region	1224	1242	N/A	INTRINSIC
low complexity region	1376	1385	N/A	INTRINSIC
Pfam:DUF4585	1598	1667	6.9e-32	PFAM
low complexity region	1723	1738	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,538	D357G	probably damaging	Het
Aatk	T	C	11: 120,009,430	K1310R	possibly damaging	Het
Acaa2	C	T	18: 74,795,159	T153M	possibly damaging	Het
Add3	A	G	19: 53,239,437	T518A	probably damaging	Het
AI314180	A	G	4: 58,849,691	Y483H	possibly damaging	Het
Cacnb4	T	C	2: 52,469,567	E143G	probably damaging	Het
Cd209a	T	A	8: 3,745,541	T177S	probably benign	Het
Chp1	T	A	2: 119,560,757	Y32N	probably damaging	Het
Clcn3	T	C	8: 60,937,368	T180A	probably damaging	Het
Dctn2	C	A	10: 127,278,404	T373N	probably benign	Het
Emb	T	A	13: 117,249,716	N136K	probably benign	Het
Enpp2	A	T	15: 54,910,140	C62S	probably damaging	Het
Fam198b	A	T	3: 79,886,608	K128*	probably null	Het
Fbxo28	G	T	1: 182,341,435	A52E	unknown	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Ggta1	T	C	2: 35,402,536	D253G	probably damaging	Het
Gps1	C	T	11: 120,786,367	A164V	probably benign	Het
Gramd4	C	T	15: 86,100,900	Q146*	probably null	Het
Kcnh5	A	T	12: 75,007,625	M515K	possibly damaging	Het
Klrc3	T	C	6: 129,639,144	T203A	probably damaging	Het
Krt26	G	T	11: 99,334,741	R305S	probably damaging	Het
Lpin1	A	G	12: 16,580,792	V35A		Het
Marf1	C	T	16: 14,132,696	R942H	probably damaging	Het
Mfhas1	T	A	8: 35,589,604	M411K	possibly damaging	Het
Mok	A	G	12: 110,808,399	S330P	probably benign	Het
Msto1	A	G	3: 88,910,128		probably null	Het
Olfr1490	T	A	19: 13,655,026	I199N	possibly damaging	Het
Omg	T	A	11: 79,502,853	I60F	possibly damaging	Het
Pcdhgb4	T	A	18: 37,722,794	C747*	probably null	Het
Pih1d1	A	G	7: 45,156,759	T40A	probably benign	Het
Pih1d2	A	T	9: 50,624,916	E290D	probably damaging	Het
Plce1	A	G	19: 38,765,404	K1849E	probably benign	Het
Plekha5	T	C	6: 140,426,545	Y74H	probably damaging	Het
Pole	T	G	5: 110,312,994	I1183S	probably damaging	Het
Ptgs1	T	C	2: 36,245,211	S396P	possibly damaging	Het
Rasa2	T	C	9: 96,557,425	E575G	probably damaging	Het
Sec22b	A	G	3: 97,901,358	T5A	probably damaging	Het
Slc18a1	T	A	8: 69,065,561	D267V	probably damaging	Het
Smad5	T	C	13: 56,727,469	F157L	probably benign	Het
Tcea1	T	A	1: 4,894,990	C294*	probably null	Het
Txndc15	T	A	13: 55,717,954	M77K	probably benign	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn2r1	T	A	3: 64,090,054	V377D	probably damaging	Het
Vmn2r7	A	G	3: 64,724,973	Y23H	probably benign	Het
Vwa3a	T	A	7: 120,795,618	M887K	possibly damaging	Het
Zbtb5	T	C	4: 44,995,196	N63D	probably damaging	Het
Zcchc6	T	C	13: 59,788,466	I1274V	possibly damaging	Het

Other mutations in 1110002E22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0026:1110002E22Rik	UTSW	3	138066805	missense	possibly damaging	0.95
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0197:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0239:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R0394:1110002E22Rik	UTSW	3	138067304	missense	probably damaging	0.99
R0401:1110002E22Rik	UTSW	3	138070306	missense	possibly damaging	0.73
R0496:1110002E22Rik	UTSW	3	138068244	missense	probably damaging	1.00
R0591:1110002E22Rik	UTSW	3	138068943	nonsense	probably null
R0711:1110002E22Rik	UTSW	3	138068225	missense	probably damaging	0.99
R0883:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0908:1110002E22Rik	UTSW	3	138070077	missense	probably damaging	0.99
R0968:1110002E22Rik	UTSW	3	138067206	missense	probably damaging	0.99
R1023:1110002E22Rik	UTSW	3	138066871	missense	probably damaging	1.00
R1168:1110002E22Rik	UTSW	3	138067900	missense	probably benign	0.20
R1472:1110002E22Rik	UTSW	3	138067552	missense	possibly damaging	0.95
R1538:1110002E22Rik	UTSW	3	138065401	missense	probably benign	0.02
R1648:1110002E22Rik	UTSW	3	138069420	missense	probably benign	0.18
R1800:1110002E22Rik	UTSW	3	138066718	missense	probably damaging	1.00
R1919:1110002E22Rik	UTSW	3	138067270	missense	probably damaging	0.99
R1974:1110002E22Rik	UTSW	3	138067267	missense	probably damaging	1.00
R1990:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R1991:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R2102:1110002E22Rik	UTSW	3	138065173	missense	probably damaging	0.99
R2761:1110002E22Rik	UTSW	3	138067780	missense	probably damaging	0.99
R2899:1110002E22Rik	UTSW	3	138065682	missense	probably benign	0.00
R3618:1110002E22Rik	UTSW	3	138068407	missense	probably damaging	1.00
R3904:1110002E22Rik	UTSW	3	138066639	missense	probably benign	0.15
R3955:1110002E22Rik	UTSW	3	138068073	missense	probably benign	0.00
R4520:1110002E22Rik	UTSW	3	138070266	missense	probably damaging	0.99
R4619:1110002E22Rik	UTSW	3	138069759	missense	probably damaging	0.99
R4736:1110002E22Rik	UTSW	3	138068485	missense	probably damaging	0.99
R4752:1110002E22Rik	UTSW	3	138069990	missense	possibly damaging	0.91
R4777:1110002E22Rik	UTSW	3	138065742	missense	probably benign	0.09
R4780:1110002E22Rik	UTSW	3	138065370	missense	probably benign	0.02
R4824:1110002E22Rik	UTSW	3	138065676	missense	probably benign	0.00
R4829:1110002E22Rik	UTSW	3	138069019	missense	probably damaging	0.99
R4965:1110002E22Rik	UTSW	3	138069672	missense	probably benign
R5206:1110002E22Rik	UTSW	3	138066511	missense	probably benign	0.00
R5212:1110002E22Rik	UTSW	3	138065850	missense	possibly damaging	0.85
R5373:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5374:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5506:1110002E22Rik	UTSW	3	138067947	missense	probably damaging	1.00
R5528:1110002E22Rik	UTSW	3	138066499	missense	probably benign
R5536:1110002E22Rik	UTSW	3	138066388	missense	possibly damaging	0.89
R5587:1110002E22Rik	UTSW	3	138065409	missense	probably benign
R5759:1110002E22Rik	UTSW	3	138068658	missense	probably benign
R5933:1110002E22Rik	UTSW	3	138070348	missense	probably damaging	1.00
R5957:1110002E22Rik	UTSW	3	138070161	missense	probably benign
R6092:1110002E22Rik	UTSW	3	138068940	missense	probably benign	0.02
R6305:1110002E22Rik	UTSW	3	138067980	missense	probably damaging	1.00
R6457:1110002E22Rik	UTSW	3	138066622	missense	probably damaging	1.00
R6469:1110002E22Rik	UTSW	3	138066975	missense	probably damaging	0.97
R6499:1110002E22Rik	UTSW	3	138068800	missense	probably damaging	1.00
R6527:1110002E22Rik	UTSW	3	138067527	missense	probably damaging	0.99
R6580:1110002E22Rik	UTSW	3	138066625	missense	probably benign	0.00
R6693:1110002E22Rik	UTSW	3	138069154	missense	probably benign	0.00
R6751:1110002E22Rik	UTSW	3	138066210	missense	probably damaging	1.00
R6852:1110002E22Rik	UTSW	3	138065169	nonsense	probably null
R6920:1110002E22Rik	UTSW	3	138068050	missense	probably damaging	1.00
R7001:1110002E22Rik	UTSW	3	138065511	missense	probably benign
R7145:1110002E22Rik	UTSW	3	138070059	missense	probably damaging	1.00
R7238:1110002E22Rik	UTSW	3	138069951	missense	probably damaging	1.00
R7278:1110002E22Rik	UTSW	3	138065476	missense	probably benign
R7425:1110002E22Rik	UTSW	3	138065695	missense	probably benign	0.00
R7487:1110002E22Rik	UTSW	3	138066868	missense	probably damaging	1.00
R7663:1110002E22Rik	UTSW	3	138066126	missense	probably damaging	0.98
R7743:1110002E22Rik	UTSW	3	138068755	missense	probably damaging	1.00
R7799:1110002E22Rik	UTSW	3	138069601	missense	probably benign	0.33
R8181:1110002E22Rik	UTSW	3	138068395	missense	probably damaging	0.99
R8264:1110002E22Rik	UTSW	3	138067782	missense	probably damaging	0.99
R8273:1110002E22Rik	UTSW	3	138066450	missense	probably benign
R8434:1110002E22Rik	UTSW	3	138067260	missense	probably damaging	0.97
R8530:1110002E22Rik	UTSW	3	138068825	missense	probably damaging	0.99
X0003:1110002E22Rik	UTSW	3	138069096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCTCCGGAAATCAAGATC -3'
(R):5'- CCTGGCACATAATCACCATAGG -3'

Sequencing Primer
(F):5'- TCCGGCTGGGAAGTGTACAG -3'
(R):5'- GGGACAAGGACCTAGATCCTC -3'

Posted On

2019-10-17