Mutagenetix > Incidental Mutations

Incidental Mutation 'R7557:1110002E22Rik'

584828

Institutional Source

Beutler Lab

Gene Symbol

1110002E22Rik

Ensembl Gene

ENSMUSG00000090066

Gene Name

RIKEN cDNA 1110002E22 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.576) question?

Stock #

R7557 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

138065052-138081506 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 138068283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1078 (Q1078*)

Ref Sequence

ENSEMBL: ENSMUSP00000123851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053318

Predicted Effect

probably null
Transcript: ENSMUST00000163080
AA Change: Q1078*

SMART Domains

Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: Q1078*

Domain	Start	End	E-Value	Type
low complexity region	44	55	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
low complexity region	422	438	N/A	INTRINSIC
low complexity region	459	505	N/A	INTRINSIC
low complexity region	667	680	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	995	1007	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
low complexity region	1224	1242	N/A	INTRINSIC
low complexity region	1376	1385	N/A	INTRINSIC
Pfam:DUF4585	1598	1667	6.9e-32	PFAM
low complexity region	1723	1738	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,538	D357G	probably damaging	Het
Aatk	T	C	11: 120,009,430	K1310R	possibly damaging	Het
Acaa2	C	T	18: 74,795,159	T153M	possibly damaging	Het
Add3	A	G	19: 53,239,437	T518A	probably damaging	Het
AI314180	A	G	4: 58,849,691	Y483H	possibly damaging	Het
Cacnb4	T	C	2: 52,469,567	E143G	probably damaging	Het
Cd209a	T	A	8: 3,745,541	T177S	probably benign	Het
Chp1	T	A	2: 119,560,757	Y32N	probably damaging	Het
Clcn3	T	C	8: 60,937,368	T180A	probably damaging	Het
Dctn2	C	A	10: 127,278,404	T373N	probably benign	Het
Emb	T	A	13: 117,249,716	N136K	probably benign	Het
Enpp2	A	T	15: 54,910,140	C62S	probably damaging	Het
Fam198b	A	T	3: 79,886,608	K128*	probably null	Het
Fbxo28	G	T	1: 182,341,435	A52E	unknown	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Ggta1	T	C	2: 35,402,536	D253G	probably damaging	Het
Gps1	C	T	11: 120,786,367	A164V	probably benign	Het
Gramd4	C	T	15: 86,100,900	Q146*	probably null	Het
Kcnh5	A	T	12: 75,007,625	M515K	possibly damaging	Het
Klrc3	T	C	6: 129,639,144	T203A	probably damaging	Het
Krt26	G	T	11: 99,334,741	R305S	probably damaging	Het
Lpin1	A	G	12: 16,580,792	V35A		Het
Marf1	C	T	16: 14,132,696	R942H	probably damaging	Het
Mfhas1	T	A	8: 35,589,604	M411K	possibly damaging	Het
Mok	A	G	12: 110,808,399	S330P	probably benign	Het
Msto1	A	G	3: 88,910,128		probably null	Het
Olfr1490	T	A	19: 13,655,026	I199N	possibly damaging	Het
Omg	T	A	11: 79,502,853	I60F	possibly damaging	Het
Pcdhgb4	T	A	18: 37,722,794	C747*	probably null	Het
Pih1d1	A	G	7: 45,156,759	T40A	probably benign	Het
Pih1d2	A	T	9: 50,624,916	E290D	probably damaging	Het
Plce1	A	G	19: 38,765,404	K1849E	probably benign	Het
Plekha5	T	C	6: 140,426,545	Y74H	probably damaging	Het
Pole	T	G	5: 110,312,994	I1183S	probably damaging	Het
Ptgs1	T	C	2: 36,245,211	S396P	possibly damaging	Het
Rasa2	T	C	9: 96,557,425	E575G	probably damaging	Het
Sec22b	A	G	3: 97,901,358	T5A	probably damaging	Het
Slc18a1	T	A	8: 69,065,561	D267V	probably damaging	Het
Smad5	T	C	13: 56,727,469	F157L	probably benign	Het
Tcea1	T	A	1: 4,894,990	C294*	probably null	Het
Txndc15	T	A	13: 55,717,954	M77K	probably benign	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn2r1	T	A	3: 64,090,054	V377D	probably damaging	Het
Vmn2r7	A	G	3: 64,724,973	Y23H	probably benign	Het
Vwa3a	T	A	7: 120,795,618	M887K	possibly damaging	Het
Zbtb5	T	C	4: 44,995,196	N63D	probably damaging	Het
Zcchc6	T	C	13: 59,788,466	I1274V	possibly damaging	Het

Other mutations in 1110002E22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0026:1110002E22Rik	UTSW	3	138066805	missense	possibly damaging	0.95
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0197:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0239:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R0394:1110002E22Rik	UTSW	3	138067304	missense	probably damaging	0.99
R0401:1110002E22Rik	UTSW	3	138070306	missense	possibly damaging	0.73
R0496:1110002E22Rik	UTSW	3	138068244	missense	probably damaging	1.00
R0591:1110002E22Rik	UTSW	3	138068943	nonsense	probably null
R0711:1110002E22Rik	UTSW	3	138068225	missense	probably damaging	0.99
R0883:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0908:1110002E22Rik	UTSW	3	138070077	missense	probably damaging	0.99
R0968:1110002E22Rik	UTSW	3	138067206	missense	probably damaging	0.99
R1023:1110002E22Rik	UTSW	3	138066871	missense	probably damaging	1.00
R1168:1110002E22Rik	UTSW	3	138067900	missense	probably benign	0.20
R1472:1110002E22Rik	UTSW	3	138067552	missense	possibly damaging	0.95
R1538:1110002E22Rik	UTSW	3	138065401	missense	probably benign	0.02
R1648:1110002E22Rik	UTSW	3	138069420	missense	probably benign	0.18
R1800:1110002E22Rik	UTSW	3	138066718	missense	probably damaging	1.00
R1919:1110002E22Rik	UTSW	3	138067270	missense	probably damaging	0.99
R1974:1110002E22Rik	UTSW	3	138067267	missense	probably damaging	1.00
R1990:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R1991:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R2102:1110002E22Rik	UTSW	3	138065173	missense	probably damaging	0.99
R2761:1110002E22Rik	UTSW	3	138067780	missense	probably damaging	0.99
R2899:1110002E22Rik	UTSW	3	138065682	missense	probably benign	0.00
R3618:1110002E22Rik	UTSW	3	138068407	missense	probably damaging	1.00
R3904:1110002E22Rik	UTSW	3	138066639	missense	probably benign	0.15
R3955:1110002E22Rik	UTSW	3	138068073	missense	probably benign	0.00
R4520:1110002E22Rik	UTSW	3	138070266	missense	probably damaging	0.99
R4619:1110002E22Rik	UTSW	3	138069759	missense	probably damaging	0.99
R4736:1110002E22Rik	UTSW	3	138068485	missense	probably damaging	0.99
R4752:1110002E22Rik	UTSW	3	138069990	missense	possibly damaging	0.91
R4777:1110002E22Rik	UTSW	3	138065742	missense	probably benign	0.09
R4780:1110002E22Rik	UTSW	3	138065370	missense	probably benign	0.02
R4824:1110002E22Rik	UTSW	3	138065676	missense	probably benign	0.00
R4829:1110002E22Rik	UTSW	3	138069019	missense	probably damaging	0.99
R4965:1110002E22Rik	UTSW	3	138069672	missense	probably benign
R5206:1110002E22Rik	UTSW	3	138066511	missense	probably benign	0.00
R5212:1110002E22Rik	UTSW	3	138065850	missense	possibly damaging	0.85
R5373:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5374:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5506:1110002E22Rik	UTSW	3	138067947	missense	probably damaging	1.00
R5528:1110002E22Rik	UTSW	3	138066499	missense	probably benign
R5536:1110002E22Rik	UTSW	3	138066388	missense	possibly damaging	0.89
R5587:1110002E22Rik	UTSW	3	138065409	missense	probably benign
R5759:1110002E22Rik	UTSW	3	138068658	missense	probably benign
R5933:1110002E22Rik	UTSW	3	138070348	missense	probably damaging	1.00
R5957:1110002E22Rik	UTSW	3	138070161	missense	probably benign
R6092:1110002E22Rik	UTSW	3	138068940	missense	probably benign	0.02
R6305:1110002E22Rik	UTSW	3	138067980	missense	probably damaging	1.00
R6457:1110002E22Rik	UTSW	3	138066622	missense	probably damaging	1.00
R6469:1110002E22Rik	UTSW	3	138066975	missense	probably damaging	0.97
R6499:1110002E22Rik	UTSW	3	138068800	missense	probably damaging	1.00
R6527:1110002E22Rik	UTSW	3	138067527	missense	probably damaging	0.99
R6580:1110002E22Rik	UTSW	3	138066625	missense	probably benign	0.00
R6693:1110002E22Rik	UTSW	3	138069154	missense	probably benign	0.00
R6751:1110002E22Rik	UTSW	3	138066210	missense	probably damaging	1.00
R6852:1110002E22Rik	UTSW	3	138065169	nonsense	probably null
R6920:1110002E22Rik	UTSW	3	138068050	missense	probably damaging	1.00
R7001:1110002E22Rik	UTSW	3	138065511	missense	probably benign
R7145:1110002E22Rik	UTSW	3	138070059	missense	probably damaging	1.00
R7238:1110002E22Rik	UTSW	3	138069951	missense	probably damaging	1.00
R7278:1110002E22Rik	UTSW	3	138065476	missense	probably benign
R7425:1110002E22Rik	UTSW	3	138065695	missense	probably benign	0.00
R7487:1110002E22Rik	UTSW	3	138066868	missense	probably damaging	1.00
R7663:1110002E22Rik	UTSW	3	138066126	missense	probably damaging	0.98
R7743:1110002E22Rik	UTSW	3	138068755	missense	probably damaging	1.00
R7799:1110002E22Rik	UTSW	3	138069601	missense	probably benign	0.33
R8181:1110002E22Rik	UTSW	3	138068395	missense	probably damaging	0.99
R8264:1110002E22Rik	UTSW	3	138067782	missense	probably damaging	0.99
R8273:1110002E22Rik	UTSW	3	138066450	missense	probably benign
R8434:1110002E22Rik	UTSW	3	138067260	missense	probably damaging	0.97
R8530:1110002E22Rik	UTSW	3	138068825	missense	probably damaging	0.99
R8754:1110002E22Rik	UTSW	3	138066037	missense	probably benign
R8808:1110002E22Rik	UTSW	3	138070113	missense	probably benign	0.01
R8891:1110002E22Rik	UTSW	3	138066759	nonsense	probably null
R9026:1110002E22Rik	UTSW	3	138065148	missense	possibly damaging	0.53
R9177:1110002E22Rik	UTSW	3	138069916	missense	probably damaging	1.00
R9250:1110002E22Rik	UTSW	3	138066628	missense	probably damaging	1.00
R9291:1110002E22Rik	UTSW	3	138066703	missense	probably benign	0.02
R9293:1110002E22Rik	UTSW	3	138066078	missense	possibly damaging	0.93
R9307:1110002E22Rik	UTSW	3	138065422	missense	probably benign	0.04
R9439:1110002E22Rik	UTSW	3	138066287	missense	probably benign	0.00
X0003:1110002E22Rik	UTSW	3	138069096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCTCCGGAAATCAAGATC -3'
(R):5'- CCTGGCACATAATCACCATAGG -3'

Sequencing Primer
(F):5'- TCCGGCTGGGAAGTGTACAG -3'
(R):5'- GGGACAAGGACCTAGATCCTC -3'

Posted On

2019-10-17