Incidental Mutation 'R7557:Plekha5'
ID584833
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140426545 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 74 (Y74H)
Ref Sequence ENSEMBL: ENSMUSP00000084904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000204145]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: Y74H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: Y74H

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203517
AA Change: Y74H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: Y74H

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204145
AA Change: Y74H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: Y74H

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7743:Plekha5 UTSW 6 140555986 missense probably damaging 1.00
R7792:Plekha5 UTSW 6 140589224 missense possibly damaging 0.80
R7808:Plekha5 UTSW 6 140583914 missense probably damaging 1.00
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGACTAATGATCTTGCCAGC -3'
(R):5'- TGTGTGGATCCATGAATACCC -3'

Sequencing Primer
(F):5'- CAGCCAAGACTTTGGATC -3'
(R):5'- TAACAAGATAATGAATGAGGCTACCC -3'
Posted On2019-10-17