Incidental Mutation 'R7557:Cd209a'
ID584836
Institutional Source Beutler Lab
Gene Symbol Cd209a
Ensembl Gene ENSMUSG00000031494
Gene NameCD209a antigen
SynonymsCIRE, DC-SIGN1, CD209, DC-SIGN, SIGNR5, Dcsign
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3743397-3748984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3745541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 177 (T177S)
Ref Sequence ENSEMBL: ENSMUSP00000012847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012847] [ENSMUST00000207979] [ENSMUST00000208960]
Predicted Effect probably benign
Transcript: ENSMUST00000012847
AA Change: T177S

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000012847
Gene: ENSMUSG00000031494
AA Change: T177S

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
CLECT 108 229 2.79e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207979
AA Change: T150S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000208960
AA Change: T118S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite altered lymphocyte numbers and increased inflammatory response.. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Cd209a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Cd209a APN 8 3748851 splice site probably benign
IGL02216:Cd209a APN 8 3745576 missense probably damaging 1.00
R0306:Cd209a UTSW 8 3745535 missense probably benign
R0696:Cd209a UTSW 8 3748384 missense possibly damaging 0.65
R1818:Cd209a UTSW 8 3745576 missense probably damaging 0.99
R4517:Cd209a UTSW 8 3745525 missense probably damaging 1.00
R4994:Cd209a UTSW 8 3747713 critical splice acceptor site probably null
R5913:Cd209a UTSW 8 3748742 missense probably benign 0.00
R6475:Cd209a UTSW 8 3747031 missense probably damaging 0.99
R7372:Cd209a UTSW 8 3748857 splice site probably null
R7570:Cd209a UTSW 8 3744151 missense probably damaging 1.00
R8898:Cd209a UTSW 8 3748739 missense probably damaging 1.00
Z1088:Cd209a UTSW 8 3747017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCTCAGGCACCTATCTGC -3'
(R):5'- GAAAGACCCAGAACTCATGGTATTC -3'

Sequencing Primer
(F):5'- ACCTATCTGCCATTCTATCTGGAC -3'
(R):5'- TATAGGTGGAACTTCCCACC -3'
Posted On2019-10-17