Incidental Mutation 'R7557:1190002N15Rik'
ID584841
Institutional Source Beutler Lab
Gene Symbol 1190002N15Rik
Ensembl Gene ENSMUSG00000045414
Gene NameRIKEN cDNA 1190002N15 gene
SynonymsGoPro49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location94517864-94538081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94520538 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 357 (D357G)
Ref Sequence ENSEMBL: ENSMUSP00000108651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113028]
Predicted Effect probably damaging
Transcript: ENSMUST00000113028
AA Change: D357G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108651
Gene: ENSMUSG00000045414
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
Pfam:PIP49_C 206 405 2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in 1190002N15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:1190002N15Rik APN 9 94520456 missense probably damaging 1.00
R0153:1190002N15Rik UTSW 9 94524480 missense probably benign 0.17
R2109:1190002N15Rik UTSW 9 94524445 missense probably damaging 0.99
R2986:1190002N15Rik UTSW 9 94520517 missense probably damaging 1.00
R4623:1190002N15Rik UTSW 9 94520398 missense possibly damaging 0.48
R4677:1190002N15Rik UTSW 9 94520404 missense probably damaging 1.00
R4705:1190002N15Rik UTSW 9 94520635 missense possibly damaging 0.68
R4876:1190002N15Rik UTSW 9 94537577 missense probably damaging 0.99
R4994:1190002N15Rik UTSW 9 94537433 missense probably benign 0.06
R5322:1190002N15Rik UTSW 9 94520562 missense probably benign 0.00
R5425:1190002N15Rik UTSW 9 94537692 missense probably damaging 0.99
R5739:1190002N15Rik UTSW 9 94520541 missense possibly damaging 0.84
R6788:1190002N15Rik UTSW 9 94524449 missense probably benign 0.14
R7390:1190002N15Rik UTSW 9 94537383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTCACATTGTGACTTAACTGTG -3'
(R):5'- TGGGATGCTCTGTATGAGAACG -3'

Sequencing Primer
(F):5'- GTGACTTAACTGTGCCAGATAGCC -3'
(R):5'- TGCTCTGTATGAGAACGTTAGGAAG -3'
Posted On2019-10-17