Incidental Mutation 'R7557:1190002N15Rik'
ID 584841
Institutional Source Beutler Lab
Gene Symbol 1190002N15Rik
Ensembl Gene ENSMUSG00000045414
Gene Name RIKEN cDNA 1190002N15 gene
Synonyms GoPro49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7557 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 94517864-94538081 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94520538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 357 (D357G)
Ref Sequence ENSEMBL: ENSMUSP00000108651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113028]
AlphaFold Q3USZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113028
AA Change: D357G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108651
Gene: ENSMUSG00000045414
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
Pfam:PIP49_C 206 405 2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in 1190002N15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:1190002N15Rik APN 9 94520456 missense probably damaging 1.00
R0153:1190002N15Rik UTSW 9 94524480 missense probably benign 0.17
R2109:1190002N15Rik UTSW 9 94524445 missense probably damaging 0.99
R2986:1190002N15Rik UTSW 9 94520517 missense probably damaging 1.00
R4623:1190002N15Rik UTSW 9 94520398 missense possibly damaging 0.48
R4677:1190002N15Rik UTSW 9 94520404 missense probably damaging 1.00
R4705:1190002N15Rik UTSW 9 94520635 missense possibly damaging 0.68
R4876:1190002N15Rik UTSW 9 94537577 missense probably damaging 0.99
R4994:1190002N15Rik UTSW 9 94537433 missense probably benign 0.06
R5322:1190002N15Rik UTSW 9 94520562 missense probably benign 0.00
R5425:1190002N15Rik UTSW 9 94537692 missense probably damaging 0.99
R5739:1190002N15Rik UTSW 9 94520541 missense possibly damaging 0.84
R6788:1190002N15Rik UTSW 9 94524449 missense probably benign 0.14
R7390:1190002N15Rik UTSW 9 94537383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTCACATTGTGACTTAACTGTG -3'
(R):5'- TGGGATGCTCTGTATGAGAACG -3'

Sequencing Primer
(F):5'- GTGACTTAACTGTGCCAGATAGCC -3'
(R):5'- TGCTCTGTATGAGAACGTTAGGAAG -3'
Posted On 2019-10-17