Incidental Mutation 'R7557:Olfr1490'
ID584861
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13655026 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 199 (I199N)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080162
AA Change: I194N

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: I194N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213900
AA Change: I199N

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0078:Olfr1490 UTSW 19 13654815 missense probably benign 0.00
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7405:Olfr1490 UTSW 19 13654882 missense probably benign 0.14
R8038:Olfr1490 UTSW 19 13655355 missense possibly damaging 0.91
R8338:Olfr1490 UTSW 19 13654852 missense possibly damaging 0.92
R8366:Olfr1490 UTSW 19 13654539 missense probably damaging 1.00
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATATGTTGCCATCTGTCATCC -3'
(R):5'- GTACATGAAGGCACAGCAGC -3'

Sequencing Primer
(F):5'- GCAGTACCCTCTCATCATGAC -3'
(R):5'- GCCATACTGCAACAATACCACAGTG -3'
Posted On2019-10-17