Incidental Mutation 'R7558:Nyap2'
ID584866
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Nameneuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
SynonymsJr6, 9430031J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location81076950-81341764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81269373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 679 (T679S)
Ref Sequence ENSEMBL: ENSMUSP00000065468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068275] [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
Predicted Effect probably benign
Transcript: ENSMUST00000068275
AA Change: T679S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065468
Gene: ENSMUSG00000054976
AA Change: T679S

DomainStartEndE-ValueType
Pfam:NYAP_N 44 447 1.5e-139 PFAM
Pfam:NYAP_C 496 709 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113494
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123285
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123720
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137862
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81192107 missense probably benign 0.03
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81241193 missense probably damaging 0.99
R4298:Nyap2 UTSW 1 81241096 missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81087274 start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCTAGAGAGCCAGTGAAAGC -3'
(R):5'- CACCACCCCTAAATTGTGCG -3'

Sequencing Primer
(F):5'- ACCTGTGGTCACCAGCAGAATG -3'
(R):5'- CGATTTTCATAAATTGCAGTGGC -3'
Posted On2019-10-17