Incidental Mutation 'R7558:Rasal2'
ID584869
Institutional Source Beutler Lab
Gene Symbol Rasal2
Ensembl Gene ENSMUSG00000070565
Gene NameRAS protein activator like 2
SynonymsA330066M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location157135182-157412595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 157175836 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 436 (R436C)
Ref Sequence ENSEMBL: ENSMUSP00000077423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543] [ENSMUST00000143358]
Predicted Effect probably damaging
Transcript: ENSMUST00000078308
AA Change: R436C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: R436C

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
PH 58 307 3.97e-8 SMART
C2 317 413 6.01e-10 SMART
RasGAP 423 767 4.56e-157 SMART
low complexity region 780 791 N/A INTRINSIC
low complexity region 1063 1075 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
coiled coil region 1117 1236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129880
SMART Domains Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
PH 128 243 8.46e-3 SMART
Pfam:C2 252 323 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132699
AA Change: R418C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: R418C

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
PH 40 289 1.7e-10 SMART
C2 299 395 4e-12 SMART
RasGAP 405 742 4.2e-153 SMART
low complexity region 755 766 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1059 1067 N/A INTRINSIC
coiled coil region 1092 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134543
SMART Domains Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
PH 45 160 8.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143358
SMART Domains Protein: ENSMUSP00000116974
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
Blast:PH 1 147 2e-83 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Rasal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Rasal2 APN 1 157147817 missense probably benign
IGL00484:Rasal2 APN 1 157174175 splice site probably null
IGL00731:Rasal2 APN 1 157157764 missense probably benign 0.01
IGL00900:Rasal2 APN 1 157411929 missense possibly damaging 0.73
IGL01346:Rasal2 APN 1 157161216 missense probably benign 0.19
IGL01635:Rasal2 APN 1 157163824 missense probably damaging 1.00
IGL01759:Rasal2 APN 1 157175932 missense probably benign 0.42
IGL01939:Rasal2 APN 1 157175910 missense probably damaging 1.00
IGL01954:Rasal2 APN 1 157177699 missense possibly damaging 0.83
IGL01954:Rasal2 APN 1 157176116 missense probably damaging 0.99
IGL02005:Rasal2 APN 1 157156998 nonsense probably null
IGL02056:Rasal2 APN 1 157299261 missense probably damaging 0.99
IGL02444:Rasal2 APN 1 157299195 missense probably benign 0.20
IGL02496:Rasal2 APN 1 157149879 missense possibly damaging 0.69
IGL02832:Rasal2 APN 1 157157207 missense probably damaging 1.00
IGL03351:Rasal2 APN 1 157192741 splice site probably benign
R0456:Rasal2 UTSW 1 157149843 missense probably damaging 1.00
R0537:Rasal2 UTSW 1 157147792 missense possibly damaging 0.46
R0681:Rasal2 UTSW 1 157157180 missense possibly damaging 0.70
R0682:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0683:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0787:Rasal2 UTSW 1 157158696 missense probably damaging 1.00
R0789:Rasal2 UTSW 1 157157321 missense probably damaging 1.00
R1109:Rasal2 UTSW 1 157177638 unclassified probably benign
R1175:Rasal2 UTSW 1 157147648 missense probably damaging 1.00
R1332:Rasal2 UTSW 1 157175821 missense probably benign 0.00
R1396:Rasal2 UTSW 1 157164666 missense probably damaging 1.00
R1535:Rasal2 UTSW 1 157230059 missense probably benign 0.28
R1542:Rasal2 UTSW 1 157175851 missense possibly damaging 0.84
R1703:Rasal2 UTSW 1 157157600 missense probably damaging 1.00
R1735:Rasal2 UTSW 1 157174160 missense probably damaging 1.00
R1762:Rasal2 UTSW 1 157299144 missense possibly damaging 0.52
R2570:Rasal2 UTSW 1 157161300 missense possibly damaging 0.85
R3148:Rasal2 UTSW 1 157243764 intron probably benign
R3157:Rasal2 UTSW 1 157158655 splice site probably benign
R4277:Rasal2 UTSW 1 157157126 missense possibly damaging 0.46
R4459:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4460:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4563:Rasal2 UTSW 1 157175991 missense probably damaging 1.00
R4672:Rasal2 UTSW 1 157243661 missense probably benign 0.10
R4894:Rasal2 UTSW 1 157192804 missense probably damaging 0.97
R5147:Rasal2 UTSW 1 157175694 missense probably damaging 1.00
R5387:Rasal2 UTSW 1 157157765 missense possibly damaging 0.81
R5421:Rasal2 UTSW 1 157299141 missense probably benign 0.37
R5459:Rasal2 UTSW 1 157157661 missense probably damaging 0.99
R5651:Rasal2 UTSW 1 157157381 missense probably damaging 1.00
R5767:Rasal2 UTSW 1 157176162 missense probably damaging 1.00
R5778:Rasal2 UTSW 1 157161290 missense probably damaging 1.00
R6298:Rasal2 UTSW 1 157411862 missense possibly damaging 0.85
R6332:Rasal2 UTSW 1 157299187 missense probably damaging 1.00
R6571:Rasal2 UTSW 1 157161179 missense possibly damaging 0.72
R7258:Rasal2 UTSW 1 157157700 missense probably damaging 0.96
R7545:Rasal2 UTSW 1 157192769 missense possibly damaging 0.93
R7894:Rasal2 UTSW 1 157243648 missense probably benign 0.01
R8140:Rasal2 UTSW 1 157299235 missense probably damaging 0.97
R8141:Rasal2 UTSW 1 157164670 missense possibly damaging 0.89
R8151:Rasal2 UTSW 1 157243584 missense probably damaging 0.96
R8218:Rasal2 UTSW 1 157157381 missense probably damaging 0.99
R8517:Rasal2 UTSW 1 157146279 critical splice acceptor site probably null
RF024:Rasal2 UTSW 1 157147790 missense probably damaging 0.97
Z1177:Rasal2 UTSW 1 157175673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCACATGGTAAGGAAGGAC -3'
(R):5'- ACCTCTTCATAGCATCACGG -3'

Sequencing Primer
(F):5'- GGTAACATACCCCTTTTGACTTAC -3'
(R):5'- CACGGTTCATATTTATAAGGATGTGG -3'
Posted On2019-10-17