Incidental Mutation 'R7558:Kif16b'
ID584875
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142758826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 462 (D462E)
Ref Sequence ENSEMBL: ENSMUSP00000042551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
Predicted Effect probably damaging
Transcript: ENSMUST00000043589
AA Change: D462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: D462E

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211861
AA Change: D462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230763
AA Change: D462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
R7376:Kif16b UTSW 2 142711872 missense probably damaging 0.99
R7381:Kif16b UTSW 2 142857423 missense probably damaging 1.00
R7681:Kif16b UTSW 2 142756126 missense probably damaging 1.00
R7896:Kif16b UTSW 2 142834075 critical splice donor site probably null
R7979:Kif16b UTSW 2 142834075 critical splice donor site probably null
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAAGGCTCAAGGATTTGTTG -3'
(R):5'- GCCTGCCAGGTTTTAAAGTCC -3'

Sequencing Primer
(F):5'- AGGCTCAAGGATTTGTTGTATATTC -3'
(R):5'- GCCAGGTTTTAAAGTCCATTTTTC -3'
Posted On2019-10-17