Incidental Mutation 'R7558:Lrrc8b'
ID584882
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Nameleucine rich repeat containing 8 family, member B
SynonymsR75581
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105415775-105490074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105481711 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 641 (W641L)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
Predicted Effect probably damaging
Transcript: ENSMUST00000112707
AA Change: W641L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: W641L

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Meta Mutation Damage Score 0.2758 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105480499 missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105481725 missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105485960 missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105485891 missense probably benign
IGL02005:Lrrc8b APN 5 105481054 missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105481837 missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105481492 missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105481549 missense probably damaging 1.00
IGL02796:Lrrc8b UTSW 5 105481345 missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105480607 missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105480112 missense possibly damaging 0.89
R1382:Lrrc8b UTSW 5 105480883 missense probably damaging 1.00
R1437:Lrrc8b UTSW 5 105481702 missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105480823 missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105481887 missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105479953 missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105480214 missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105480946 missense probably damaging 1.00
R5264:Lrrc8b UTSW 5 105480252 missense probably damaging 0.98
R5424:Lrrc8b UTSW 5 105480703 missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105485984 missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105480297 missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R5800:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R6637:Lrrc8b UTSW 5 105480271 missense possibly damaging 0.80
R7249:Lrrc8b UTSW 5 105481267 missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105481656 missense probably benign 0.01
R8077:Lrrc8b UTSW 5 105480017 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTGCTGAACAACCTGAAGAAG -3'
(R):5'- CACAGCAAAGTACTGCAGATTGG -3'

Sequencing Primer
(F):5'- GATGGTCAATCTGAAAAGCCTG -3'
(R):5'- ACTGCAGATTGGTCAGGTAC -3'
Posted On2019-10-17